DBX1 (NM_001029865) Human Untagged Clone
CAT＃: SC302449
DBX1 (untagged)-Human developing brain homeobox 1 (DBX1)
CNY 3656.00
CNY 6180.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001029865 edited
GCCACCATGATGTTCCCCGGCCTCCTCGCGCCCCCCGCCGGGTACCCTAGCCTCCTGCGG CCCACGCCCACCTTGACGCTGCCCCAGTCCTTGCAGTCGGCATTTTCCGGCCACTCCAGC TTCCTGGTGGAGGATCTGATCCGCATCAGCCGACCCCCCGCCTACCTGCCCCGCAGCGTG CCCACCGCCAGCATGTCGCCGCCCAGGCAGGGGGCCCCCACGGCCCTCACCGACACGGGG GCCTCGGACCTGGGCTCCCCGGGTCCCGGCAGCCGACGGGGCGGCTCTCCGCCGACTGCC TTCTCCCCTGCCAGCGAGACGACGTTTCTGAAGTTTGGAGTGAACGCCATCCTCTCCTCG GGGCCCAGAACAGAAACATCCCCAGCCTTGCTCCAGAGCGTCCCTCCCAAGACCTTCGCC TTTCCCTACTTCGAAGGGTCTTTTCAGCCTTTCATCAGATCTTCTTATTTCCCAGCTTCC TCCAGCGTGGTGCCCATCCCCGGGACCTTCTCCTGGCCGCTGGCCGCGCGCGGGAAGCCT CGGCGGGGCATGCTGCGTCGAGCAGTCTTCTCCGACGTGCAGCGGAAGGCGCTGGAGAAG ATGTTCCAGAAGCAGAAGTACATCAGCAAGCCCGACCGCAAGAAGCTGGCGGCCAAGCTG GGCCTGAAAGACTCGCAGGTGAAAATCTGGTTCCAGAACCGACGCATGAAATGGCGGAAC TCCAAGGAGCGCGAACTCCTGTCTAGCGGGGGCTGTCGCGAGCAGACCCTGCCCACCAAG CTCAATCCGCACCCGGACCTCAGCGACGTGGGCCAGAAGGGCCCTGGGAACGAAGAGGAG GAGGAGGGCCCGGGCAGCCCCAGCCACCGCCTGGCCTACCACGCGTCCTCCGACCCCCAG CACCTGCGGGACCCGCGGCTGCCAGGGCCGCTGCCCCCCTCGCCCGCGCACTCGAGCAGT CCCGGGAAACCTTCGGACTTCTCAGATTCCGAGGAGGAAGAGGAGGGCGAGGAACAGGAG GAAATCACCGTGTCCTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001029865 |
| Insert Size | 1100 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001029865.1, NP_001025036.1 |
| RefSeq Size | 1149 bp |
| RefSeq ORF | 1149 bp |
| Locus ID | 120237 |
| UniProt ID | A6NMT0 |
| Gene Summary | Could have a role in patterning the central nervous system during embryogenesis. Has a key role in regulating the distinct phenotypic features that distinguish two major classes of ventral interneurons, V0 and V1 neurons. Regulates the transcription factor profile, neurotransmitter phenotype, intraspinal migratory path and axonal trajectory of V0 neurons, features that differentiate them from an adjacent set of V1 neurons (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224662 | DBX1 (Myc-DDK-tagged)-Human developing brain homeobox 1 (DBX1) |
CNY 3656.00 |
|
| RC224662L3 | Lenti-ORF clone of DBX1 (Myc-DDK-tagged)-Human developing brain homeobox 1 (DBX1) |
CNY 5890.00 |
|
| RC224662L4 | Lenti-ORF clone of DBX1 (mGFP-tagged)-Human developing brain homeobox 1 (DBX1) |
CNY 5890.00 |
|
| RG224662 | DBX1 (tGFP-tagged) - Human developing brain homeobox 1 (DBX1) |
CNY 4370.00 |
