B7H3 (CD276) (NM_001024736) Human Untagged Clone
CAT#: SC302298
CD276 (untagged)-Human CD276 molecule (CD276), transcript variant 1
CNY 5976.00
Product images

CNY 1999.00
CNY 3600.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 4Ig-B7-H3; B7-H3; B7H3; B7RP-2 |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001024736, the custom clone sequence may differ by one or more nucleotides
ATGCTGCGTCGGCGGGGCAGCCCTGGCATGGGTGTGCATGTGGGTGCAGCCCTGGGAGCACTGTGGTTCT GCCTCACAGGAGCCCTGGAGGTCCAGGTCCCTGAAGACCCAGTGGTGGCACTGGTGGGCACCGATGCCAC CCTGTGCTGCTCCTTCTCCCCTGAGCCTGGCTTCAGCCTGGCACAGCTCAACCTCATCTGGCAGCTGACA GATACCAAACAGCTGGTGCACAGCTTTGCTGAGGGCCAGGACCAGGGCAGCGCCTATGCCAACCGCACGG CCCTCTTCCCGGACCTGCTGGCACAGGGCAACGCATCCCTGAGGCTGCAGCGCGTGCGTGTGGCGGACGA GGGCAGCTTCACCTGCTTCGTGAGCATCCGGGATTTCGGCAGCGCTGCCGTCAGCCTGCAGGTGGCCGCT CCCTACTCGAAGCCCAGCATGACCCTGGAGCCCAACAAGGACCTGCGGCCAGGGGACACGGTGACCATCA CGTGCTCCAGCTACCAGGGCTACCCTGAGGCTGAGGTGTTCTGGCAGGATGGGCAGGGTGTGCCCCTGAC TGGCAACGTGACCACGTCGCAGATGGCCAACGAGCAGGGCTTGTTTGATGTGCACAGCATCCTGCGGGTG GTGCTGGGTGCAAATGGCACCTACAGCTGCCTGGTGCGCAACCCCGTGCTGCAGCAGGATGCGCACAGCT CTGTCACCATCACACCCCAGAGAAGCCCCACAGGAGCCGTGGAGGTCCAGGTCCCTGAGGACCCGGTGGT GGCCCTAGTGGGCACCGATGCCACCCTGCGCTGCTCCTTCTCCCCCGAGCCTGGCTTCAGCCTGGCACAG CTCAACCTCATCTGGCAGCTGACAGACACCAAACAGCTGGTGCACAGTTTCACCGAAGGCCGGGACCAGG GCAGCGCCTATGCCAACCGCACGGCCCTCTTCCCGGACCTGCTGGCACAAGGCAATGCATCCCTGAGGCT GCAGCGCGTGCGTGTGGCGGACGAGGGCAGCTTCACCTGCTTCGTGAGCATCCGGGATTTCGGCAGCGCT GCCGTCAGCCTGCAGGTGGCCGCTCCCTACTCGAAGCCCAGCATGACCCTGGAGCCCAACAAGGACCTGC GGCCAGGGGACACGGTGACCATCACGTGCTCCAGCTACCGGGGCTACCCTGAGGCTGAGGTGTTCTGGCA GGATGGGCAGGGTGTGCCCCTGACTGGCAACGTGACCACGTCGCAGATGGCCAACGAGCAGGGCTTGTTT GATGTGCACAGCGTCCTGCGGGTGGTGCTGGGTGCGAATGGCACCTACAGCTGCCTGGTGCGCAACCCCG TGCTGCAGCAGGATGCGCACGGCTCTGTCACCATCACAGGGCAGCCTATGACATTCCCCCCAGAGGCCCT GTGGGTGACCGTGGGGCTGTCTGTCTGTCTCATTGCACTGCTGGTGGCCCTGGCTTTCGTGTGCTGGAGA AAGATCAAACAGAGCTGTGAGGAGGAGAATGCAGGAGCTGAGGACCAGGATGGGGAGGGAGAAGGCTCCA AGACAGCCCTGCAGCCTCTGAAACACTCTGACAGCAAAGAAGATGATGGACAAGAAATAGCCTGA |
Restriction Sites | EcoRI-NotI |
ACCN | NM_001024736 |
Insert Size | 2600 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone is found to be a perfect match to NM_001024736.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001024736.1, NP_001019907.1 |
RefSeq Size | 3419 bp |
RefSeq ORF | 1605 bp |
Locus ID | 80381 |
UniProt ID | Q5ZPR3 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Cell adhesion molecules (CAMs) |
Gene Summary | The protein encoded by this gene belongs to the immunoglobulin superfamily, and thought to participate in the regulation of T-cell-mediated immune response. Studies show that while the transcript of this gene is ubiquitously expressed in normal tissues and solid tumors, the protein is preferentially expressed only in tumor tissues. Additionally, it was observed that the 3' UTR of this transcript contains a target site for miR29 microRNA, and there is an inverse correlation between the expression of this protein and miR29 levels, suggesting regulation of expression of this gene product by miR29. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215064 | CD276 (Myc-DDK-tagged)-Human CD276 molecule (CD276), transcript variant 1 |
CNY 5960.00 |
|
RC215064L3 | Lenti-ORF clone of CD276 (Myc-DDK-tagged)-Human CD276 molecule (CD276), transcript variant 1 |
CNY 8360.00 |
|
RC215064L4 | Lenti-ORF clone of CD276 (mGFP-tagged)-Human CD276 molecule (CD276), transcript variant 1 |
CNY 8360.00 |
|
RG215064 | CD276 (tGFP-tagged) - Human CD276 molecule (CD276), transcript variant 1 |
CNY 7560.00 |