HES3 (NM_001024598) Human Untagged Clone
CAT#: SC302258
HES3 (untagged)-Human hairy and enhancer of split 3 (Drosophila) (HES3)
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | bHLHb43 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001024598 edited
ATGGAGAAAAAGCGCCGGGCACGCATCAATGTGTCACTGGAGCAGCTCAAGTCGCTGCTG GAGAAACACTACTCGCACCAGATCCGGAAGCGCAAATTGGAGAAGGCCGACATCCTGGAG TTGAGCGTGAAGTACATGAGAAGCCTTCAGAACTCCTTGCAAGGGCTCTGGCCTGTGCCC AGGGGAGCCGAGCAACCGTCGGGCTTCCGCAGCTGCCTGCCCGGCGTGAGCCAGCTCCTT CGGCGCGGAGATGAGGTCGGCAGCGGCCTGCGCTGCCCCCTGGTGCCCGAGAGCGCCGCC GGCAGCACCATGGACAGCGCCGGGTTGGGCCAGGAGGCGCCCGCGCTGTTCCGCCCTTGC ACCCCTGCCGTCTGGGCTCCTGCTCCGGCCGCCGGCGGCCCGCGGTCCCCACCACCCCTG CTCCTCCTCCCCGAAAGTCTCCCTGGCTCGTCCGCCAGCGTCCCCCCGCCGCAGCCAGCG TCGAGTCGCTGCGCCGAGAGTCCCGGGCTGGGCCTGCGCGTGTGGCGGCCCTGGGGAAGC CCCGGGGATGACCTGAACTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001024598 |
| Insert Size | 600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001024598.1, NP_001019769.1 |
| RefSeq Size | 1355 bp |
| RefSeq ORF | 561 bp |
| Locus ID | 390992 |
| UniProt ID | Q5TGS1 |
| Gene Summary | Transcriptional repressor of genes that require a bHLH protein for their transcription.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224630 | HES3 (Myc-DDK-tagged)-Human hairy and enhancer of split 3 (Drosophila) (HES3) |
CNY 2400.00 |
|
| RC224630L1 | Lenti ORF clone of Human hairy and enhancer of split 3 (Drosophila) (HES3), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC224630L2 | Lenti ORF clone of Human hairy and enhancer of split 3 (Drosophila) (HES3), mGFP tagged |
CNY 5890.00 |
|
| RC224630L3 | Lenti ORF clone of Human hairy and enhancer of split 3 (Drosophila) (HES3), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC224630L4 | Lenti ORF clone of Human hairy and enhancer of split 3 (Drosophila) (HES3), mGFP tagged |
CNY 5890.00 |
|
| RG224630 | HES3 (tGFP-tagged) - Human hairy and enhancer of split 3 (Drosophila) (HES3) |
CNY 4370.00 |
