FBLIM1 (NM_001024216) Human Untagged Clone
CAT#: SC302237
FBLIM1 (untagged)-Human filamin binding LIM protein 1 (FBLIM1), transcript variant 3
CNY 6270.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CAL; FBLP-1; FBLP1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC302237 representing NM_001024216.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCTCAAAGCCTGAGAAGAGGGTGGCATCGTCTGTCTTTATCACCCTGGCACCCCCGCGCCGCGAT GTGGCCGTGGCGGAGGAAGTGAGGCAGGCAGTTTGTGAGGCCCGGCGTGGCCGCCCCTGGGAGGCTCCT GCCCCCATGAAGACACCCGAGGCTGGCTTGGCGGGGAGGCCCAGCCCCTGGACAACCCCTGGCAGAGCT GCAGCCACAGTGCCGGCTGCACCTATGCAGCTCTTCAATGGAGACATCTGTGCCTTCTGCCACAAGACC GTGTCCCCCCGAGAGCTGGCTGTGGAGGCCATGAAGAGGCAGTACCATGCCCAGTGCTTCACGTGCCGC ACCTGCCGCCGCCAGCTGGCTGGGCAGAGCTTCTACCAGAAGGATGGGCGACCCCTCTGCGAACCCTGC TACCAGGACACACTGGAGAGGTGCGGCAAGTGTGGCGAGGTGGTCCGGGACCACATCATCAGGGCCCTG GGCCAGGCCTTCCACCCCTCCTGCTTCACGTGTGTGACCTGCGCCCGGTGCATTGGGGATGAGAGCTTT GCCCTGGGCAGCCAGAACGAGGTGTACTGCCTGGACGACTTCTACAGGAAATTCGCCCCCGTCTGCAGC ATCTGTGAAAATCCCATCATCCCTCGGGATGGGAAAGATGCCTTCAAAATCGAATGCATGGGAAGAAAC TTCCATGAAAATTGCTACAGGTGTGAGGACTGCAGGATCCTCCTGTCTGTCGAGCCCACGGACCAAGGC TGCTACCCCCTGAACAACCATCTCTTCTGCAAGCCATGCCATGTGAAGCGGAGTGCTGCGGGGTGCTGC TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001024216 |
| Insert Size | 831 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001024216.1 |
| RefSeq Size | 2793 bp |
| RefSeq ORF | 831 bp |
| Locus ID | 54751 |
| UniProt ID | Q8WUP2 |
| MW | 30.8 kDa |
| Gene Summary | This gene encodes a protein with an N-terminal filamin-binding domain, a central proline-rich domain, and, multiple C-terminal LIM domains. This protein localizes at cell junctions and may link cell adhesion structures to the actin cytoskeleton. This protein may be involved in the assembly and stabilization of actin-filaments and likely plays a role in modulating cell adhesion, cell morphology and cell motility. This protein also localizes to the nucleus and may affect cardiomyocyte differentiation after binding with the CSX/NKX2-5 transcription factor. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks multiple alternate in-frame exons, compared to variant 1, resulting in a shorter protein (isoform c), compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211828 | FBLIM1 (Myc-DDK-tagged)-Human filamin binding LIM protein 1 (FBLIM1), transcript variant 3 |
CNY 2400.00 |
|
| RC211828L3 | Lenti ORF clone of Human filamin binding LIM protein 1 (FBLIM1), transcript variant 3, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC211828L4 | Lenti ORF clone of Human filamin binding LIM protein 1 (FBLIM1), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
| RG211828 | FBLIM1 (tGFP-tagged) - Human filamin binding LIM protein 1 (FBLIM1), transcript variant 3 |
CNY 4370.00 |
