MTCP1 (NM_001018025) Human Untagged Clone
CAT＃: SC302131
MTCP1 (untagged)-Human mature T-cell proliferation 1 (MTCP1), nuclear gene encoding mitochondrial protein
CNY 1200.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | p8MTCP1; P13MTCP1; TCL1C |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001018025 edited
GGAACCCAAAGCCCAGAATGGCAGGAGAGGATGTGGGGGCTCCACCCGATCACCTCTGGG TTCACCAAGAGGGTATCTACCGCGACGAATACCAGCGCACGTGGGTGGCCGTCGTGGAAG AGGAGACGAGTTTCCTAAGGGCACGAGTCCAGCAAATTCAGGTTCCCTTAGGTGACGCAG CTAGGCCAAGTCACCTTCTTACCTCCCAGCTACCTCTCATGTGGCAACTCTACCCGGAGG AGCGCTACATGGATAACAACTCTCGCTTGTGGCAGATACAGCATCATTTAATGGTCAGGG GAGTACAGGAGCTGTTGCTTAAGCTTTTGCCTGATGACTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001018025 |
| Insert Size | 350 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001018025.2, NP_001018025.1 |
| RefSeq Size | 1943 bp |
| RefSeq ORF | 324 bp |
| Locus ID | 4515 |
| UniProt ID | P56278 |
| Gene Summary | This gene was identified by involvement in some t(X;14) translocations associated with mature T-cell proliferations. This region has a complex gene structure, with a common promoter and 5' exon spliced to two different sets of 3' exons that encode two different proteins. This gene represents the upstream 13 kDa protein that is a member of the TCL1 family. This protein may be involved in leukemogenesis. [provided by RefSeq, Mar 2009] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217513 | MTCP1 (Myc-DDK-tagged)-Human mature T-cell proliferation 1 (MTCP1), nuclear gene encoding mitochondrial protein |
CNY 1200.00 |
|
| RC217513L1 | Lenti ORF clone of Human mature T-cell proliferation 1 (MTCP1), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 3600.00 |
|
| RC217513L2 | Lenti ORF clone of Human mature T-cell proliferation 1 (MTCP1), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5890.00 |
|
| RC217513L3 | Lenti ORF clone of Human mature T-cell proliferation 1 (MTCP1), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC217513L4 | Lenti ORF clone of Human mature T-cell proliferation 1 (MTCP1), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5890.00 |
|
| RG217513 | MTCP1 (tGFP-tagged) - Human mature T-cell proliferation 1 (MTCP1), nuclear gene encoding mitochondrial protein |
CNY 4370.00 |
