COP (CARD16) (NM_001017534) Human Untagged Clone

CAT#: SC302066

CARD16 (untagged)-Human caspase recruitment domain family, member 16 (CARD16), transcript variant 1



  "NM_001017534" in other vectors (4)

CNY 3600.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CARD16 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms COP; COP1; PSEUDO-ICE
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001017534 edited
ATGGCCGACAAGGTCCTGAAGGAGAAGAGAAAGCTGTTTATCCATTCCATGGGTGAAGGT
ACAATAAATGGCTTACTGGATGAATTATTACAGACAAGGGTGCTGAACCAGGAAGAGATG
GAGAAAGTAAAACGTGAAAATGCTACAGTTATGGATAAGACCCGAGCTTTGATTGACTCC
GTTATTCCGAAAGGGGCACAGGCATGCCAAATTTGCATCACATACATTTGTGAAGAAGAC
AGTTACCTGGCAGAGACGCTGGGACTCTCAGCAGCTCTTCAGGCAGTGCAGGACAACCCA
GCTATGCCCACATGCTCAAGCCCAGAAGGCAGAATCAAGCTTTGCTTTCTAGAAGACGCT
CAAAGGATATGGAAACAAAAGTTGCAGAGGTGCCATGTTCAGAATACAATAATAAAGTGG
AGTGAAAGATATACTTCAGGCAGTTTTGAAATGCAGTGGCTTTTTCTTAGAACCAATTTT
ATTGAGCGGTTCTGGAGGAACATACTTCTGCTCCCCTTGCATAAAGGATCTCTATATCCT
AGAATCCCAGGTTTAGGTAAAGAGTTGCAAACTGGAACTCATAAATTATCATAG
Restriction Sites Please inquire     
ACCN NM_001017534
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001017534.1, NP_001017534.1
RefSeq Size 695 bp
RefSeq ORF 594 bp
Locus ID 114769
UniProt ID Q5EG05
Gene Summary Caspase inhibitor. Acts as a regulator of procaspase-1/CASP1 activation implicated in the regulation of the proteolytic maturation of pro-interleukin-1 beta (IL1B) and its release during inflammation. Inhibits the release of IL1B in response to LPS in monocytes. Also induces NF-kappa-B activation during the pro-inflammatory cytokine response. Also able to inhibit CASP1-mediated neuronal cell death, TNF-alpha, hypoxia-, UV-, and staurosporine-mediated cell death but not ER stress-mediated cell death. Acts by preventing activation of caspases CASP1 and CASP4, possibly by preventing the interaction between CASP1 and RIPK2.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the shorter transcript but encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...