IL31 (NM_001014336) Human Untagged Clone
CAT#: SC301922
IL31 (untagged)-Human interleukin 31 (IL31)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | IL-31 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001014336 edited
ATGGCCTCTCACTCAGGCCCCTCGACGTCTGTGCTCTTTCTGTTCTGCTGCCTGGGAGGC TGGCTGGCCTCCCACACGTTGCCCGTCCGTTTACTACGACCAAGTGATGATGTACAGAAA ATAGTCGAGGAATTACAGTCCCTCTCGAAGATGCTTTTGAAAGATGTGGAGGAAGAGAAG GGCGTGCTCGTGTCCCAGAATTACACGCTGCCGTGTCTCAGCCCTGACGCCCAGCCGCCA AACAACATCCACAGCCCAGCCATCCGGGCATATCTCAAGACAATCAGACAGCTAGACAAC AAATCTGTTATTGATGAGATCATAGAGCACCTCGACAAACTCATATTTCAAGATGCACCA GAAACAAACATTTCTGTGCCAACAGACACCCATGAATGTAAACGCTTCATCCTGACTATT TCTCAACAGTTTTCAGAGTGCATGGACCTCGCACTAAAATCATTGACCTCTGGAGCCCAA CAGGCCACCACTTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001014336 |
| Insert Size | 500 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001014336.1, NP_001014358.1 |
| RefSeq Size | 904 bp |
| RefSeq ORF | 495 bp |
| Locus ID | 386653 |
| UniProt ID | Q6EBC2 |
| Protein Families | Secreted Protein, Transmembrane |
| Gene Summary | IL31, which is made principally by activated Th2-type T cells, interacts with a heterodimeric receptor consisting of IL31RA (MIM 609510) and OSMR (MIM 601743) that is constitutively expressed on epithelial cells and keratinocytes. IL31 may be involved in the promotion of allergic skin disorders and in regulating other allergic diseases, such as asthma (Dillon et al., 2004 [PubMed 15184896]).[supplied by OMIM, Mar 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223858 | IL31 (Myc-DDK-tagged)-Human interleukin 31 (IL31) |
CNY 1200.00 |
|
| RC223858L1 | Lenti ORF clone of Human interleukin 31 (IL31), Myc-DDK-tagged |
CNY 3600.00 |
|
| RC223858L2 | Lenti ORF clone of Human interleukin 31 (IL31), mGFP tagged |
CNY 5890.00 |
|
| RC223858L3 | Lenti ORF clone of Human interleukin 31 (IL31), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC223858L4 | Lenti ORF clone of Human interleukin 31 (IL31), mGFP tagged |
CNY 5890.00 |
|
| RG223858 | IL31 (tGFP-tagged) - Human interleukin 31 (IL31) |
CNY 2800.00 |
