HNRNPCL1 (NM_001013631) Human Untagged Clone
CAT#: SC301806
HNRNPCL1 (untagged)-Human heterogeneous nuclear ribonucleoprotein C-like 1 (HNRNPCL1)
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HNRPCL1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001013631 edited
AACACAATGGCCAGCAACGTTACCAACAAGATGGATCCTCACTCCATGAACTCCCGTGTG TTCATTGGGAATCTCAACACTCTTGTTGTCAAGAAATCGGATGTGGAGGCGATCTTTTCC AAGTATGGCAAAATTGCGGGCTGCTCTGTTCATAAGGGCTTTGCCTTCGTTCAATATGAT AAGGAGAAAAATGCCCGGGCTGCTGTAGCAGGAGAGGATGGCAGAATGATTGCTAGCCAG GTTGTAGATATTAACCTGGCTGCAGAGCCAAAAGTGAACCGAGGAAACGCAGGTGTGAAA CGATCAGCAGCGGAGATGTACGGCTCCTCTTTTGACTTGGACTATGGCTTTCAACGGGAT TATTATGATGGAATGTACAGTTTCCCAGCACGTGTACCTCCTCCTCCTCCCATTGCTCTG GCTGTAGTGCCCTCGAAACGTCAACGTCTATCAGGAAACACCTCACGAAGGGGCAAAAGT GGCTTCAATTCTAAGAGTGGAAAGCGGGGATCTTCCAAGTCTGGAAAGTTGAAAGGTGAT GACCTTCAGGCCATTAAGCAGGAGTTGACCCAGATAAAACAGAAAGTGGATTCTCTCCTG GAAAACCTGGAAAAAATTGAAAAGGAACAGAGCAAACAAGAGGTAGAGGTGAAAAATGCT AAGTCAGAAGAGGAGCAGAGCAGTAGCTCCATGAAGAAAGATGAGACTCATGTGAAGATG GAGTCTGAGGGGGGTGCAGAAGACTCTGCTGAGGAGGGGGACCCACTGGATGATGATGTT AATGAAGATCAGGGGGATGACCAGCTGGAGTTGATCAAGGATGATGAAAAAGAGGCTGAG GAAGGAGAGGATGACAGAGACAGCACCAATGGCCAGGATGACTCTTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001013631 |
| Insert Size | 900 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001013631.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001013631.1, NP_001013653.1 |
| RefSeq Size | 1108 bp |
| RefSeq ORF | 882 bp |
| Locus ID | 343069 |
| UniProt ID | O60812 |
| Gene Summary | May play a role in nucleosome assembly by neutralizing basic proteins such as A and B core hnRNPs.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212000 | HNRNPCL1 (Myc-DDK-tagged)-Human heterogeneous nuclear ribonucleoprotein C-like 1 (HNRNPCL1) |
CNY 2400.00 |
|
| RC212000L1 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein C-like 1 (HNRNPCL1), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC212000L2 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein C-like 1 (HNRNPCL1), mGFP tagged |
CNY 5890.00 |
|
| RC212000L3 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein C-like 1 (HNRNPCL1), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC212000L4 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein C-like 1 (HNRNPCL1), mGFP tagged |
CNY 5890.00 |
|
| RG212000 | HNRNPCL1 (tGFP-tagged) - Human heterogeneous nuclear ribonucleoprotein C-like 1 (HNRNPCL1) |
CNY 4370.00 |
其它HNRNPCL1产品
