DUSP15 (NM_001012644) Human Untagged Clone
CAT#: SC301688
DUSP15 (untagged)-Human dual specificity phosphatase 15 (DUSP15), transcript variant 3
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C20orf57; VHY |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001012644, the custom clone sequence may differ by one or more nucleotides
ATGACTGTGACGGGGCTAGGCTGGCGGGACGTGCTTGAAGCCATCAAGGCCACCAGGCCC ATCGCCAACCCCAACCCAGGCTTTAGGCAGCAGCTTGAAGAGTTTGGCTGGGCCAGTTCC CAGAAGCTTCGCCGGCAGCTGGAGGAGCGCTTCGGCGAGAGCCCCTTCCGCGACGAGGAG GAGTTGCGCGCGCTGCTGCCGCTGTGCAAGCGCTGCCGGCAGGGCTCCGCGACCTCGGCC TCCTCCGCCGGGCCGCACTCAGCAGCCTCCGAGGGAACCGTGCAGCGCCTGGTGCCGCGC ACGCCCCGGGAAGCCCACCGGCCGCTGCCGCTGCTGGCGCGCGTCAAGCAGACTTTCTCT TGCCTCCCCCGGTGTCTGTCCCGCAAGGGCGGCAAGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001012644 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001012644.1, NP_001012662.1 |
RefSeq Size | 1212 bp |
RefSeq ORF | 399 bp |
Locus ID | 128853 |
UniProt ID | Q9H1R2 |
Protein Families | Druggable Genome, Phosphatase |
Gene Summary | The protein encoded by this gene has both protein-tyrosine phophatase activity and serine/threonine-specific phosphatase activity, and therefore is known as a dual specificity phosphatase. This protein may function in the differentiation of oligodendrocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon compared to isoform a. Variants 2 and 3 both encode isoform b, which has a shorter N-terminus than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208956 | DUSP15 (Myc-DDK-tagged)-Human dual specificity phosphatase 15 (DUSP15), transcript variant 3 |
CNY 2400.00 |
|
RC208956L3 | Lenti-ORF clone of DUSP15 (Myc-DDK-tagged)-Human dual specificity phosphatase 15 (DUSP15), transcript variant 3 |
CNY 5890.00 |
|
RC208956L4 | Lenti-ORF clone of DUSP15 (mGFP-tagged)-Human dual specificity phosphatase 15 (DUSP15), transcript variant 3 |
CNY 5890.00 |
|
RG208956 | DUSP15 (tGFP-tagged) - Human dual specificity phosphatase 15 (DUSP15), transcript variant 3 |
CNY 4370.00 |