CRLF2 (NM_001012288) Human Untagged Clone

CAT#: SC301624

CRLF2 (untagged)-Human cytokine receptor-like factor 2 (CRLF2), transcript variant 2



  "NM_001012288" in other vectors (4)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-CRLF2 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CRL2; CRLF2Y; TSLPR
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001012288 edited
AACGGTGATGAGGCCTATGACCAGTGCACCAACTACCTTCTCCAGGAAGGTCACACTTCG
GGGTGCCTCCTAGACGCAGAGCAGCGAGACGACATTCTCTATTTCTCCATCAGGAATGGG
ACGCACCCCGTTTTCACCGCAAGTCGCTGGATGGTTTATTACCTGAAACCCAGTTCCCCG
AAGCACGTGAGATTTTCGTGGCATCAGGATGCAGTGACGGTGACGTGTTCTGACCTGTCC
TACGGGGATCTCCTCTATGAGGTTCAGTACCGGAGCCCCTTCGACACCGAGTGGCAGTCC
AAACAGGAAAATACCTGCAACGTCACCATAGAAGGCTTGGATGCCGAGAAGTGTTACTCT
TTCTGGGTCAGGGTGAAGGCTATGGAGGATGTATATGGGCCAGACACATACCCAAGCGAC
TGGTCAGAGGTGACATGCTGGCAGAGAGGCGAGATTCGGGATGCCTGTGCAGAGACACCA
ACGCCTCCCAAACCAAAGCTGTCCAAATTTATTTTAATTTCCAGCCTGGCCATCCTTCTG
ATGGTGTCTCTCCTCCTTCTGTCTTTATGGAAATTATGGAGAGTGAGGAAGTTTCTCATT
CCCAGCGTGCCAGACCCGAAATCCATCTTCCCCGGGCTCTTTGAGATACACCAAGGGAAC
TTCCAGGAGTGGATCACAGACACCCAGAACGTGGCCCACCTCCACAAGATGGCAGGTGCA
GAGCAAGGAAGTGGCCCCGAGGAGCCCCTGGTAGTCCAGTTGGCCAAGACTGAAGCCGAG
TCTCCCAGGATGCTGGACCCACAGACCGAGGAGAAAGAGGCCTCTGGGGGATCCCTCCAG
CTTCCCCACCAGCCCCTCCAAGGCGGTGATGTGGTCACAATCGGGGGCTTCACCTTTGTG
ATGAATGACCGCTCCTACGTGGCGTTGTGATCTAGATTG
Restriction Sites Please inquire     
ACCN NM_001012288
Insert Size 930 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_001012288.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001012288.1, NP_001012288.1
RefSeq Size 1013 bp
RefSeq ORF 780 bp
Locus ID 64109
UniProt ID Q9HC73
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
Gene Summary This gene encodes a member of the type I cytokine receptor family. The encoded protein is a receptor for thymic stromal lymphopoietin (TSLP). Together with the interleukin 7 receptor (IL7R), the encoded protein and TSLP activate STAT3, STAT5, and JAK2 pathways, which control processes such as cell proliferation and development of the hematopoietic system. Rearrangement of this gene with immunoglobulin heavy chain gene (IGH) on chromosome 14, or with P2Y purinoceptor 8 gene (P2RY8) on the same X or Y chromosomes is associated with B-progenitor acute lymphoblastic leukemia (ALL) and Down syndrome ALL. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (2) lacks an alternate exon which results in translation initiation at a downstream start codon compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...