CRLF2 (NM_001012288) Human Untagged Clone
CAT#: SC301624
CRLF2 (untagged)-Human cytokine receptor-like factor 2 (CRLF2), transcript variant 2
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CRL2; CRLF2Y; TSLPR |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001012288 edited
AACGGTGATGAGGCCTATGACCAGTGCACCAACTACCTTCTCCAGGAAGGTCACACTTCG GGGTGCCTCCTAGACGCAGAGCAGCGAGACGACATTCTCTATTTCTCCATCAGGAATGGG ACGCACCCCGTTTTCACCGCAAGTCGCTGGATGGTTTATTACCTGAAACCCAGTTCCCCG AAGCACGTGAGATTTTCGTGGCATCAGGATGCAGTGACGGTGACGTGTTCTGACCTGTCC TACGGGGATCTCCTCTATGAGGTTCAGTACCGGAGCCCCTTCGACACCGAGTGGCAGTCC AAACAGGAAAATACCTGCAACGTCACCATAGAAGGCTTGGATGCCGAGAAGTGTTACTCT TTCTGGGTCAGGGTGAAGGCTATGGAGGATGTATATGGGCCAGACACATACCCAAGCGAC TGGTCAGAGGTGACATGCTGGCAGAGAGGCGAGATTCGGGATGCCTGTGCAGAGACACCA ACGCCTCCCAAACCAAAGCTGTCCAAATTTATTTTAATTTCCAGCCTGGCCATCCTTCTG ATGGTGTCTCTCCTCCTTCTGTCTTTATGGAAATTATGGAGAGTGAGGAAGTTTCTCATT CCCAGCGTGCCAGACCCGAAATCCATCTTCCCCGGGCTCTTTGAGATACACCAAGGGAAC TTCCAGGAGTGGATCACAGACACCCAGAACGTGGCCCACCTCCACAAGATGGCAGGTGCA GAGCAAGGAAGTGGCCCCGAGGAGCCCCTGGTAGTCCAGTTGGCCAAGACTGAAGCCGAG TCTCCCAGGATGCTGGACCCACAGACCGAGGAGAAAGAGGCCTCTGGGGGATCCCTCCAG CTTCCCCACCAGCCCCTCCAAGGCGGTGATGTGGTCACAATCGGGGGCTTCACCTTTGTG ATGAATGACCGCTCCTACGTGGCGTTGTGATCTAGATTG |
Restriction Sites | Please inquire |
ACCN | NM_001012288 |
Insert Size | 930 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_001012288.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001012288.1, NP_001012288.1 |
RefSeq Size | 1013 bp |
RefSeq ORF | 780 bp |
Locus ID | 64109 |
UniProt ID | Q9HC73 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway |
Gene Summary | This gene encodes a member of the type I cytokine receptor family. The encoded protein is a receptor for thymic stromal lymphopoietin (TSLP). Together with the interleukin 7 receptor (IL7R), the encoded protein and TSLP activate STAT3, STAT5, and JAK2 pathways, which control processes such as cell proliferation and development of the hematopoietic system. Rearrangement of this gene with immunoglobulin heavy chain gene (IGH) on chromosome 14, or with P2Y purinoceptor 8 gene (P2RY8) on the same X or Y chromosomes is associated with B-progenitor acute lymphoblastic leukemia (ALL) and Down syndrome ALL. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (2) lacks an alternate exon which results in translation initiation at a downstream start codon compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223766 | CRLF2 (Myc-DDK-tagged)-Human cytokine receptor-like factor 2 (CRLF2), transcript variant 2 |
CNY 3990.00 |
|
RC223766L3 | Lenti-ORF clone of CRLF2 (Myc-DDK-tagged)-Human cytokine receptor-like factor 2 (CRLF2), transcript variant 2 |
CNY 5890.00 |
|
RC223766L4 | Lenti-ORF clone of CRLF2 (mGFP-tagged)-Human cytokine receptor-like factor 2 (CRLF2), transcript variant 2 |
CNY 5890.00 |
|
RG223766 | CRLF2 (tGFP-tagged) - Human cytokine receptor-like factor 2 (CRLF2), transcript variant 2 |
CNY 4370.00 |