BIRC5 (NM_001012270) Human Untagged Clone

CAT#: SC301617

BIRC5 (untagged)-Human baculoviral IAP repeat containing 5 (BIRC5/Survivin), transcript variant 2



  "NM_001012270" in other vectors (4)

CNY 1200.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Cited in 2 publications.

Product images

推荐一起购买 (4)
Anti-BIRC5/Survivin mouse monoclonal antibody, clone OTI2D9 (formerly 2D9)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms API4; EPR-1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001012270 edited
ATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCT
ACATTCAAGAACTGGCCCTTCTTGGAGGGCTGCGCCTGCACCCCGGAGCGGATGGCCGAG
GCTGGCTTCATCCACTGCCCCACTGAGAACGAGCCAGACTTGGCCCAGTGTTTCTTCTGC
TTCAAGGAGCTGGAAGGCTGGGAGCCAGATGACGACCCCATGCAAAGGAAACCAACAATA
AGAAGAAAGAATTTGAGGAAACTGCGGAGAAAGTGCGCCGTGCCATCGAGCAGCTGGCTG
CCATGGATTGAGGCCTCTGGCCGGAGCTGCCTGGTCCCAGAGTGGCTGCACCACTTCCAG
GGTTTATTCCCTGGTGCCACCAGCCTTCCTGTGGGCCCCTTAGCAATGTCTTAG
Restriction Sites Please inquire     
ACCN NM_001012270
Insert Size 2800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001012270.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001012270.1, NP_001012270.1
RefSeq Size 2537 bp
RefSeq ORF 414 bp
Locus ID 332
UniProt ID O15392
Protein Families Druggable Genome, Stem cell - Pluripotency
Protein Pathways Colorectal cancer, Pathways in cancer
Gene Summary This gene is a member of the inhibitor of apoptosis (IAP) gene family, which encode negative regulatory proteins that prevent apoptotic cell death. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but this gene encodes proteins with only a single BIR domain. The encoded proteins also lack a C-terminus RING finger domain. Gene expression is high during fetal development and in most tumors, yet low in adult tissues. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Transcript Variant: This variant (2), also known as survivin-deltaEx3, lacks an exon in the 3' coding region which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus when it is compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (2)

Other Versions

Customer Reviews 
Loading...