Heterogeneous Nuclear Ribonucleoprotein (A1 like) (HNRNPA1L2) (NM_001011724) Human Untagged Clone
CAT#: SC301609
HNRNPA1L2 (untagged)-Human heterogeneous nuclear ribonucleoprotein A1-like 2 (HNRNPA1L2), transcript variant 1
CNY 2400.00
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001011724 edited
CACCTTGCCGTCATGTCTAAGTCAGCGTCTCCAAAAGAGCCCGAACAGCTGAGGAAGCTC TTCATTGGAGGGTTGAGCTTTGAAACAACTGATGAGAGCCTGAGGAGCCATTTTGAGCAA TGGGGAACGCTCACAGACTGTGTGGTAATGAGAGATCCAAACACCAAGCGCTCCAGGGGC TTTGGGTTTGTCACATATGCCACTGTGGAGGAGGTGGATGCAGCTATGAATACAACGCCA CACAAGGTGGATGGAAGAGTTGTGGAACCAAAGAGAGCTGTCTCCAGAGAAGATTCTCAA AGACCAGGTGCCCACTTAACTGTGAAAAAGATATTTGTTGGTGGCATTAAAGAAGACACT GAAGAACATCACCTAAGAGATTATTTTGAACAGTATGGAAAAATTGAAGTAATTGAAATC ATGACTGACCGAGGCAGTGGCAAGAAAAGGGGCTTTGCCTTTGTAACCTTTGACGACCAT GACTCCGTGGATAAGATTGTCATTCAGAAATACCATACTGTGAAGGGCCACAACTGTGAA GTTAGAAAAGCCCTGCCAAAGCAAGAGATGGCTAGTGCTTCATCCAGCCAAAGAGGTCGA AGGGGTTCTGGAAACTTTGGTGGTGGTCGTGGAGATGGTTTCGGTGGGAATGACAACTTT GGTCGTGGAGGAAACTTCAGTGGTCGTGGTGGCTTTGGTGGCAGCTGTGGTGGTGGTGGA TATGGTGGCAGTGGGGATGGCTATAATGGATTTGGTAATGATGGAAGCAATTTTGGAGGT GGTGGAAGCTACAATGATTTTGGCAATTACAACAATCAGTCTTCAAATTTTGGACCCATG AAGGGAGGAAATTTTGGAGGCAGAAGCTCTGGCCCCTATGGCGGTGGAGGCCAATACTTT GCAAAACCACAAAACCAAGGTGGCTATGGCGTTTCCAGCAGCAGCAGTAGCTATGGCAGT GGCAGAAGATTTTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001011724 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001011724.1, NP_001011724.1 |
| RefSeq Size | 2365 bp |
| RefSeq ORF | 963 bp |
| Locus ID | 144983 |
| UniProt ID | Q32P51 |
| Protein Pathways | Spliceosome |
| Gene Summary | Involved in the packaging of pre-mRNA into hnRNP particles, transport of poly(A) mRNA from the nucleus to the cytoplasm and may modulate splice site selection.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218191 | HNRNPA1L2 (Myc-DDK-tagged)-Human heterogeneous nuclear ribonucleoprotein A1-like 2 (HNRNPA1L2), transcript variant 1 |
CNY 2400.00 |
|
| RC218191L1 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein A1-like 2 (HNRNPA1L2), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
| RC218191L2 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein A1-like 2 (HNRNPA1L2), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC218191L3 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein A1-like 2 (HNRNPA1L2), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC218191L4 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein A1-like 2 (HNRNPA1L2), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG218191 | HNRNPA1L2 (tGFP-tagged) - Human heterogeneous nuclear ribonucleoprotein A1-like 2 (HNRNPA1L2), transcript variant 1 |
CNY 4000.00 |
其它Heterogeneous Nuclear Ribonucleoprotein (A1 like)产品
