HGF (NM_001010931) Human Untagged Clone
CAT#: SC301538
HGF (untagged)-Human hepatocyte growth factor (hepapoietin A, scatter factor) (HGF), transcript variant 2
CNY 2400.00
CNY 6270.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DFNB39; F-TCF; HGFB; HPTA; SF |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001010931 edited
ATGTGGGTGACCAAACTCCTGCCAGCCCTGCTGCTGCAGCATGTCCTCCTGCATCTCCTC CTGCTCCCCATCGCCATCCCCTATGCAGAGGGACAAAGGAAAAGAAGAAATACAATTCAT GAATTCAAAAAATCAGCAAAGACTACCCTAATCAAAATAGATCCAGCACTGAAGATAAAA ACCAAAAAAGTGAATACTGCAGACCAATGTGCTAATAGATGTACTAGGAATAAAGGACTT CCATTCACTTGCAAGGCTTTTGTTTTTGATAAAGCAAGAAAACAATGCCTCTGGTTCCCC TTCAATAGCATGTCAAGTGGAGTGAAAAAAGAATTTGGCCATGAATTTGACCTCTATGAA AACAAAGACTACATTAGAAACTGCATCATTGGTAAAGGACGCAGCTACAAGGGAACAGTA TCTATCACTAAGAGTGGCATCAAATGTCAGCCCTGGAGTTCCATGATACCACACGAACAC AGCTTTTTGCCTTCGAGCTATCGGGGTAAAGACCTACAGGAAAACTACTGTCGAAATCCT CGAGGGGAAGAAGGGGGACCCTGGTGTTTCACAAGCAATCCAGAGGTACGCTACGAAGTC TGTGACATTCCTCAGTGTTCAGAAGTTGAATGCATGACCTGCAATGGGGAGAGTTATCGA GGTCTCATGGATCATACAGAATCAGGCAAGATTTGTCAGCGCTGGGATCATCAGACACCA CACCGGCACAAATTCTTGCCTGAAAGATATCCCGACAAGGGCTTTGATGATAATTATTGC CGCAATCCCGATGGCCAGCCGAGGCCATGGTGCTATACTCTTGACCCTCACACCCGCTGG GAGTACTGTGCAATTAAAACATGCGAGACATAA |
Restriction Sites | Please inquire |
ACCN | NM_001010931 |
Insert Size | 800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_001010931.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001010931.1, NP_001010931.1 |
RefSeq Size | 1307 bp |
RefSeq ORF | 873 bp |
Locus ID | 3082 |
UniProt ID | P14210 |
Protein Families | Adult stem cells, Druggable Genome, ES Cell Differentiation/IPS, Protease, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction, Focal adhesion, Melanoma, Pathways in cancer, Renal cell carcinoma |
Gene Summary | This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate alpha and beta chains, which form the mature heterodimer. This protein is secreted by mesenchymal cells and acts as a multi-functional cytokine on cells of mainly epithelial origin. This protein also plays a role in angiogenesis, tumorogenesis, and tissue regeneration. Although the encoded protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Mutations in this gene are associated with nonsyndromic hearing loss. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (2) lacks multiple 3' exons but includes an alternate 3' exon, compared to variant 1. The resulting protein (isoform 2) has a shorter and distinct C-terminus, compared to isoform 1. Isoform 2, also named NK2, has been shown to act as a competitive antagonist to active hepatocyte growth factor for the c-Met receptor. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213241 | HGF (Myc-DDK-tagged)-Human hepatocyte growth factor (hepapoietin A, scatter factor) (HGF), transcript variant 2 |
CNY 2400.00 |
|
RC213241L3 | Lenti ORF clone of Human hepatocyte growth factor (hepapoietin A; scatter factor) (HGF), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC213241L4 | Lenti ORF clone of Human hepatocyte growth factor (hepapoietin A; scatter factor) (HGF), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG213241 | HGF (tGFP-tagged) - Human hepatocyte growth factor (hepapoietin A; scatter factor) (HGF), transcript variant 2 |
CNY 4000.00 |