RIPPLY2 (NM_001009994) Human Untagged Clone
CAT#: SC301467
RIPPLY2 (untagged)-Human ripply2 homolog (zebrafish) (RIPPLY2)
CNY 3990.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C6orf159; dJ237I15.1; SCDO6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301467 representing NM_001009994.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGAACGCGGGAGGCGCAGAGGGTACAGAGAGTGGAGCTGCGGCGTGCGCGGCCACCGACGGCCCT ACGCGGCGCGCGGGCGCGGACTCCGGATACGCAGGCTTCTGGAGACCCTGGGTGGACGCCGGAGGCAAG AAAGAAGAGGAGACGCCGAACCACGCCGCGGAGGCGATGCCCGATGGCCCTGGAATGACCGCAGCCTCA GGAAAGCTTTACCAATTCAGGCACCCAGTCAGACTATTTTGGCCAAAATCAAAATGTTATGATTACTTA TATCAAGAAGCAGAAGCTCTTCTGAAAAATTTTCCAATTCAAGCCACAATTTCATTTTATGAAGATTCT GATAGCGAAGATGAAATTGAGGATCTGACCTGTGAAAATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001009994 |
Insert Size | 387 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001009994.2 |
RefSeq Size | 674 bp |
RefSeq ORF | 387 bp |
Locus ID | 134701 |
UniProt ID | Q5TAB7 |
MW | 13.9 kDa |
Gene Summary | This gene encodes a nuclear protein that belongs to a novel family of proteins required for vertebrate somitogenesis. Members of this family have a tetrapeptide WRPW motif that is required for interaction with the transcriptional repressor Groucho and a carboxy-terminal Ripply homology domain/Bowline-DSCR-Ledgerline conserved region required for transcriptional repression. Null mutant mice die soon after birth and display defects in axial skeleton segmentation due to defective somitogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (1) represents the longer transcript and encodes the protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220725 | RIPPLY2 (Myc-DDK-tagged)-Human ripply2 homolog (zebrafish) (RIPPLY2) |
CNY 1200.00 |
|
RC220725L3 | Lenti ORF clone of Human ripply2 homolog (zebrafish) (RIPPLY2), Myc-DDK-tagged |
CNY 5890.00 |
|
RC220725L4 | Lenti ORF clone of Human ripply2 homolog (zebrafish) (RIPPLY2), mGFP tagged |
CNY 5890.00 |
|
RG220725 | RIPPLY2 (tGFP-tagged) - Human ripply2 homolog (zebrafish) (RIPPLY2) |
CNY 2800.00 |
其它RIPPLY2产品