SPANXN1 (NM_001009614) Human Untagged Clone
CAT＃: SC301421
SPANXN1 (untagged)-Human SPANX family, member N1 (SPANXN1)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CT11.6 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001009614, the custom clone sequence may differ by one or more nucleotides
ATGGAACAGCCCACTTCAAGCATCAATGGGGAGAAGAGGAAGAGCCCCTGTGAATCCAAC AATGAAAATGATGAGATGCAGGAGACACCAAACAGGGACTTAGCCCCCGAACCGAGTTTG AAAAAGATGAAAACGTCAGAATATTCAACAGTATTAGCGTTTTGCTACAGGAAAGCTAAG AAAATACATTCAAATCAACTGGAGAATGACCAGTCCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001009614 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001009614.1, NP_001009614.1 |
| RefSeq Size | 1276 bp |
| RefSeq ORF | 219 bp |
| Locus ID | 494118 |
| UniProt ID | Q5VSR9 |
| Gene Summary | This gene represents one of several duplicated family members that are located on chromosome X. This gene family encodes proteins that play a role in spermiogenesis. These proteins represent a specific subgroup of cancer/testis-associated antigens, and they may be candidates for tumor vaccines. This family member belongs to a subgroup of related genes that are present in all primates and rats and mice, and thus, it represents one of the ancestral family members. [provided by RefSeq, May 2010] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215915 | SPANXN1 (Myc-DDK-tagged)-Human SPANX family, member N1 (SPANXN1) |
CNY 3990.00 |
|
| RC215915L3 | Lenti-ORF clone of SPANXN1 (Myc-DDK-tagged)-Human SPANX family, member N1 (SPANXN1) |
CNY 5890.00 |
|
| RC215915L4 | Lenti-ORF clone of SPANXN1 (mGFP-tagged)-Human SPANX family, member N1 (SPANXN1) |
CNY 5890.00 |
|
| RG215915 | SPANXN1 (tGFP-tagged) - Human SPANX family, member N1 (SPANXN1) |
CNY 4370.00 |
其它SPANXN1产品
