STK16 (NM_001008910) Human Untagged Clone
CAT#: SC301388
STK16 (untagged)-Human serine/threonine kinase 16 (STK16), transcript variant 1
CNY 6270.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | hPSK; KRCT; MPSK; PKL12; PSK; TSF1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC301388 representing NM_001008910.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGCCACGCGCTGTGTGTCTGCTCTCGGGGAACTGTCATCATTGACAATAAGCGCTACCTCTTCATC CAGAAACTGGGGGAGGGTGGGTTCAGCTATGTGGACCTAGTGGAAGGGTTACATGATGGACACTTCTAC GCCCTGAAGCGAATCCTGTGTCACGAGCAGCAGGACCGGGAGGAGGCCCAGCGAGAAGCCGACATGCAT CGCCTCTTCAATCACCCCAACATCCTTCGCCTCGTGGCTTACTGTCTGAGGGAACGGGGTGCTAAGCAT GAGGCCTGGCTGCTGCTACCATTCTTCAAGAGAGGTACGCTGTGGAATGAGATAGAAAGGCTGAAGGAC AAAGGCAACTTCCTGACCGAGGATCAAATCCTTTGGCTGCTGCTGGGGATCTGCAGAGGCCTTGAGGCC ATTCATGCCAAGGGTTATGCCCACAGAGACTTGAAGCCCACCAATATATTGCTTGGAGATGAGGGGCAG CCAGTTTTAATGGACTTGGGTTCCATGAATCAAGCATGCATCCATGTGGAGGGCTCCCGCCAGGCTCTG ACCCTGCAGGACTGGGCAGCCCAGCGGTGCACCATCTCCTACCGAGCCCCAGAGCTCTTCTCTGTGCAG AGTCACTGTGTCATCGATGAGCGGACTGATGTCTGGTCCCTAGGCTGCGTGCTATATGCCATGATGTTT GGGGAAGGCCCTTATGACATGGTGTTCCAAAAGGGTGACAGTGTGGCCCTTGCTGTGCAGAACCAACTC AGCATCCCACAAAGCCCCAGGCATTCTTCAGCATTGCGGCAGCTCCTGAACTCGATGATGACCGTGGAC CCGCATCAGCGTCCTCACATTCCTCTCCTCCTCAGTCAGCTGGAGGCGCTGCAGCCCCCAGCTCCTGGC CAACATACTACCCAAATCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001008910 |
| Insert Size | 918 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001008910.2 |
| RefSeq Size | 2903 bp |
| RefSeq ORF | 918 bp |
| Locus ID | 8576 |
| UniProt ID | O75716 |
| Protein Families | Druggable Genome, Protein Kinase |
| MW | 34.7 kDa |
| Gene Summary | Membrane-associated protein kinase that phosphorylates on serine and threonine residues. In vitro substrates include DRG1, ENO1 and EIF4EBP1. Also autophosphorylates. May be involved in secretory vesicle trafficking or intracellular signaling. May have a role in regulating stromal-epithelial interactions that occur during ductal morphogenesis in the mammary gland. May be involved in TGF-beta signaling. Able to autophosphorylate on Tyr residue; it is however unclear whether it has tyrosine-protein kinase toward other proteins.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest protein (isoform 1). |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Cardiac-specific overexpression of sarcolipin in phospholamban mice impairs myocyte function that is restored by phosphorylation
,Anthony O. Gramolini, Maria G. Trivieri, Gavin Y. Oudit, Thomas Kislinger, Wenping Li, Mikin M. Patel, Andrew Emili, Evangelia G. Kranias, Peter H. Backx, and David H. MacLennan,
Proc Natl Acad Sci U S A. 2006 Feb 14;103(7):2446-51.
[STK16]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219087 | STK16 (Myc-DDK-tagged)-Human serine/threonine kinase 16 (STK16), transcript variant 1 |
CNY 2400.00 |
|
| RC219087L1 | Lenti ORF clone of Human serine/threonine kinase 16 (STK16), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
| RC219087L2 | Lenti ORF clone of Human serine/threonine kinase 16 (STK16), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC219087L3 | Lenti ORF clone of Human serine/threonine kinase 16 (STK16), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC219087L4 | Lenti ORF clone of Human serine/threonine kinase 16 (STK16), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG219087 | STK16 (tGFP-tagged) - Human serine/threonine kinase 16 (STK16), transcript variant 1 |
CNY 4000.00 |

