DECTIN 2 (CLEC6A) (NM_001007033) Human Untagged Clone
CAT#: SC301138
CLEC6A (untagged)-Human C-type lectin domain family 6, member A (CLEC6A)
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CLEC4N; CLECSF10; dectin-2; hDECTIN-2 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>SC301138 representing NM_001007033.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGATGCAAGAGCAGCAACCTCAAAGTACAGAGAAAAGAGGCTGGTTGTCCCTGAGACTCTGGTCTGTG GCTGGGATTTCCATTGCACTCCTCAGTGCTTGCTTCATTGTGAGCTGTGTAGTAACTTACCATTTTACA TATGGTGAAACTGGCAAAAGGCTGTCTGAACTACACTCATATCATTCAAGTCTCACCTGCTTCAGTGAA GGGACAAAGGTGCCAGCCTGGGGATGTTGCCCAGCTTCTTGGAAGTCATTTGGTTCCAGTTGCTACTTC ATTTCCAGTGAAGAGAAGGTTTGGTCTAAGAGTGAGCAGAACTGTGTTGAGATGGGAGCACATTTGGTT GTGTTCAACACAGAAGCAGAGCAGAATTTCATTGTCCAGCAGCTGAATGAGTCATTTTCTTATTTTCTG GGGCTTTCAGACCCACAAGGTAATAATAATTGGCAATGGATTGATAAGACACCTTATGAGAAAAATGTC AGATTTTGGCACCTAGGTGAGCCCAATCATTCTGCAGAGCAATGTGCTTCAATAGTCTTCTGGAAACCT ACAGGATGGGGCTGGAATGATGTTATCTGTGAAACTAGAAGGAATTCAATATGTGAGATGAATAAGATT TACCTATGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001007033 |
| Insert Size | 630 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001007033.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001007033.1 |
| RefSeq Size | 1613 bp |
| RefSeq ORF | 630 bp |
| Locus ID | 93978 |
| UniProt ID | Q6EIG7 |
| Protein Families | Transmembrane |
| MW | 24 kDa |
| Gene Summary | The protein encoded by this gene is a type II membrane receptor with an extracellular C-type lectin-like domain fold. The extracellular portion binds structures with a high mannose content and has been shown to recognize several pathogens, including C. elegans, S. cerevisiae, M. tuberculosis, C. neoformans, and house dust mite. When stimulated, the encoded protein initiates signalling through the CARD9-Bcl10-Malt1 pathway, leading to the induction of cytokines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212780 | CLEC6A (Myc-DDK-tagged)-Human C-type lectin domain family 6, member A (CLEC6A) |
CNY 2400.00 |
|
| RC212780L1 | Lenti ORF clone of Human C-type lectin domain family 6, member A (CLEC6A), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC212780L2 | Lenti ORF clone of Human C-type lectin domain family 6, member A (CLEC6A), mGFP tagged |
CNY 5890.00 |
|
| RC212780L3 | Lenti ORF clone of Human C-type lectin domain family 6, member A (CLEC6A), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC212780L4 | Lenti ORF clone of Human C-type lectin domain family 6, member A (CLEC6A), mGFP tagged |
CNY 4800.00 |
|
| RG212780 | CLEC6A (tGFP-tagged) - Human C-type lectin domain family 6, member A (CLEC6A) |
CNY 4000.00 |
其它DECTIN 2产品
