TCEAL1 (NM_001006640) Human Untagged Clone

CAT#: SC301101

TCEAL1 (untagged)-Human transcription elongation factor A (SII)-like 1 (TCEAL1), transcript variant 3



  "NM_001006640" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TCEAL1 mouse monoclonal antibody, clone OTI2G10 (formerly 2G10)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms p21; pp21; SIIR; WEX9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301101 representing NM_001006640.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACAAACCACGCAAAGAAAATGAAGAAGAGCCGCAGAGCGCGCCCAAGACCGATGAGGAGAGGCCT
CCGGTGGAGCACTCTCCCGAAAAGCAGTCCCCCGAGGAGCAGTCTTCGGAGGAGCAGTCCTCGGAGGAG
GAGTTCTTTCCTGAGGAGCTCTTGCCTGAGCTCCTGCCTGAGATGCTCCTCTCGGAGGAGCGCCCTCCG
CAGGAGGGTCTTTCCAGGAAGGACCTGTTTGAGGGGCGCCCTCCCATGGAGCAGCCTCCTTGTGGAGTA
GGAAAACATAAGCTTGAAGAAGGAAGCTTTAAAGAAAGGTTGGCTCGTTCTCGCCCGCAATTTAGAGGG
GACATACATGGCAGAAATTTAAGCAATGAGGAGATGATACAGGCAGCAGATGAGCTAGAAGAGATGAAA
AGAGTAAGAAACAAACTGATGATAATGCACTGGAAGGCAAAACGGAGCCGTCCTTATCCTATTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001006640
Insert Size 480 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001006640.1
RefSeq Size 1220 bp
RefSeq ORF 480 bp
Locus ID 9338
UniProt ID Q15170
Protein Families Transcription Factors
MW 18.6 kDa
Gene Summary This gene encodes a member of the transcription elongation factor A (SII)-like (TCEAL) gene family. Members of this family may function as nuclear phosphoproteins that modulate transcription in a promoter context-dependent manner. The encoded protein is similar to transcription elongation factor A/transcription factor SII and contains a zinc finger-like motif as well as a sequence related to the transcription factor SII Pol II-binding region. It may exert its effects via protein-protein interactions with other transcriptional regulators rather than via direct binding of DNA. Multiple family members are located on the X chromosome. Alternative splicing results in multiple transcript variants encoding a single isoform. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1 through 3 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...