WDR33 (NM_001006623) Human Untagged Clone
CAT#: SC301084
WDR33 (untagged)-Human WD repeat domain 33 (WDR33), transcript variant 3
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | NET14; WDC146 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301084 representing NM_001006623.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTACAGAAATTGGTTCTCCTCCTCGTTTTTTCCATATGCCAAGGTTCCAGCACCAGGCACCTCGA CAGCTGTTTTATAAGCGACCTGATTTTGCACAACAGCAAGCAATGCAACAGCTTACTTTTGATGGAAAA CGAATGAGAAAAGCTGTGAACCGAAAAACCATAGACTACAATCCATCTGTAATTAAGTATTTGGAGAAC AGAATATGGCAAAGAGACCAGAGAGATATGCGGGCAATTCAGCCTGATGCAGGTTATTACAATGATCTG GTCCCACCTATAGGAATGTTGAATAATCCTATGAATGCAGTAACAACAAAATTTGTTCGGACATCAACA AATAAAGTAAAGTGTCCTGTATTTGTTGTTAGGTGGACTCCAGAAGGAAGACGCTTGGTCACTGGAGCT TCTAGTGGGGAGTTTACCCTGTGGAATGGACTCACTTTCAATTTTGAAACAATATTACAGGCTCACGAC AGCCCAGTGAGGGCCATGACGTGGTCACATAATGACATGTGGATGTTGACAGCAGACCACGGAGGATAT GTGAAATATTGGCAGTCGAACATGAACAACGTCAAGATGTTCCAGGCACATAAGGAGGCGATTAGAGAG GCCAGTTTCTCACCCACGGATAATAAATTTGCTACATGCTCTGATGACGGCACTGTTAGAATCTGGGAC TTTCTTCGTTGCCATGAGGAAAGAATTCTCCGAGATACATGTTTTCATCACTGCCGTTGTTACTTCCTT TCTGTCAAGAGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001006623 |
Insert Size | 774 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001006623.2 |
RefSeq Size | 3598 bp |
RefSeq ORF | 774 bp |
Locus ID | 55339 |
UniProt ID | Q9C0J8 |
Protein Families | Stem cell - Pluripotency |
MW | 30.3 kDa |
Gene Summary | This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is highly expressed in testis and the protein is localized to the nucleus. This gene may play important roles in the mechanisms of cytodifferentiation and/or DNA recombination. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks multiple 3' exons but has an alternate 3' exon, as compared to variant 1. It encodes the shortest isoform (3), which has a shorter and distinct C-terminus, as compared to isoform 1, has only two WD repeats, and lacks the collagen-like and GPR domains. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216403 | WDR33 (Myc-DDK-tagged)-Human WD repeat domain 33 (WDR33), transcript variant 3 |
CNY 2400.00 |
|
RC216403L1 | Lenti ORF clone of Human WD repeat domain 33 (WDR33), transcript variant 3, Myc-DDK-tagged |
CNY 4800.00 |
|
RC216403L2 | Lenti ORF clone of Human WD repeat domain 33 (WDR33), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
RC216403L3 | Lenti ORF clone of Human WD repeat domain 33 (WDR33), transcript variant 3, Myc-DDK-tagged |
CNY 5890.00 |
|
RC216403L4 | Lenti ORF clone of Human WD repeat domain 33 (WDR33), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
RG216403 | WDR33 (tGFP-tagged) - Human WD repeat domain 33 (WDR33), transcript variant 3 |
CNY 4370.00 |