WDR33 (NM_001006623) Human Untagged Clone

CAT#: SC301084

WDR33 (untagged)-Human WD repeat domain 33 (WDR33), transcript variant 3



  "NM_001006623" in other vectors (6)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-WDR33 Antibody
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NET14; WDC146
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301084 representing NM_001006623.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTACAGAAATTGGTTCTCCTCCTCGTTTTTTCCATATGCCAAGGTTCCAGCACCAGGCACCTCGA
CAGCTGTTTTATAAGCGACCTGATTTTGCACAACAGCAAGCAATGCAACAGCTTACTTTTGATGGAAAA
CGAATGAGAAAAGCTGTGAACCGAAAAACCATAGACTACAATCCATCTGTAATTAAGTATTTGGAGAAC
AGAATATGGCAAAGAGACCAGAGAGATATGCGGGCAATTCAGCCTGATGCAGGTTATTACAATGATCTG
GTCCCACCTATAGGAATGTTGAATAATCCTATGAATGCAGTAACAACAAAATTTGTTCGGACATCAACA
AATAAAGTAAAGTGTCCTGTATTTGTTGTTAGGTGGACTCCAGAAGGAAGACGCTTGGTCACTGGAGCT
TCTAGTGGGGAGTTTACCCTGTGGAATGGACTCACTTTCAATTTTGAAACAATATTACAGGCTCACGAC
AGCCCAGTGAGGGCCATGACGTGGTCACATAATGACATGTGGATGTTGACAGCAGACCACGGAGGATAT
GTGAAATATTGGCAGTCGAACATGAACAACGTCAAGATGTTCCAGGCACATAAGGAGGCGATTAGAGAG
GCCAGTTTCTCACCCACGGATAATAAATTTGCTACATGCTCTGATGACGGCACTGTTAGAATCTGGGAC
TTTCTTCGTTGCCATGAGGAAAGAATTCTCCGAGATACATGTTTTCATCACTGCCGTTGTTACTTCCTT
TCTGTCAAGAGGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001006623
Insert Size 774 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001006623.2
RefSeq Size 3598 bp
RefSeq ORF 774 bp
Locus ID 55339
UniProt ID Q9C0J8
Protein Families Stem cell - Pluripotency
MW 30.3 kDa
Gene Summary This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is highly expressed in testis and the protein is localized to the nucleus. This gene may play important roles in the mechanisms of cytodifferentiation and/or DNA recombination. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) lacks multiple 3' exons but has an alternate 3' exon, as compared to variant 1. It encodes the shortest isoform (3), which has a shorter and distinct C-terminus, as compared to isoform 1, has only two WD repeats, and lacks the collagen-like and GPR domains.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...