PLAUR (NM_001005376) Human Untagged Clone
CAT#: SC300933
PLAUR (untagged)-Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 2
CNY 2400.00
CNY 6270.00
Cited in 2 publications. |
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD87; U-PAR; UPAR; URKR |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001005376 edited
CCTTCCTGAGGCCAGAAGGAGAGAAGACGTGCAGGGACCCCGCGCACAGGAGCTGCCCTC GCGACATGGGTCACCCGCCGCTGCTGCCGCTGCTGCTGCTGCTCCACACCTGCGTCCCAG CCTCTTGGGGCCTGCGGTGCATGCAGTGTAAGACCAACGGGGATTGCCGTGTGGAAGAGT GCGCCCTGGGACAGGACCTCTGCAGGACCACGATCGTGCGCTTGTGGGAAGAAGGAGAAG AGCTGGAGCTGGTGGAGAAAAGCTGTACCCACTCAGAGAAGACCAACAGGACCCTGAGCT ATCGGACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTGTGTGGGTTAGACTTGTGCA ACCAGGGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTACCTCGAATGCATTT CCTGTGGCTCATCAGACATGAGCTGTGAGAGGGGCCGGCACCAGAGCCTGCAGTGCCGCA GCCCTGAAGAACAGTGCCTGGATGTGGTGACCCACTGGATCCAGGAAGGTGAAGAAGGGC GTCCAAAGGATGACCGCCACCTCCGTGGCTGTGGCTACCTTCCCGGCTGCCCGGGCTCCA ATGGTTTCCACAACAACGACACCTTCCACTTCCTGAAATGCTGCAACACCACCAAATGCA ACGAGGGCCCAATCCTGGAGCTTGAAAATCTGCCGCAGAATGGCCGCCAGTGTTACAGCT GCAAGGGGAACAGCACCCATGGATGCTCCTCTGAAGAGACTTTCCTCATTGACTGCCGAG GCCCCATGAATCAATGTCTGGTAGCCACCGGCACTCACGAACGCTCACTCTGGGGAAGCT GGTTGCCATGTAAAAGTACTACTGCCCTGAGACCACCATGCTGTGAGGAAGCCCAAGCTA CTCATGTATAAACCACATTGATGTCTCCTGCTGTACTAAAAGTGGCTGTAACCACCCAGA CCTGGATGTCCAGTACCGCAGTGGGGCTGCTCCTCAGCCTGGCCCTGCCCATCTCAGCCT CACCATCACCCTGCTAATGACTGCCAGACTGTGGGGAGGCACTCTCCTCTGGACCTAAAC CTGAAATCCCCCTCTCTGCCCTGGCTGGATCCGGGGGACCCCTTTGCCCTTCCCTCGGCT CCCAGCCCTACAGACTTGCTGTGTGACCTCAGGCCAGTGTGCCGACCTCTCTGGGCCTCA GTTTTCCCAGCTATGAAAACAGCTATCTCACAAAGTTGTGTGAAGCAGAAGAGAAAAGCT GGAGGAAGGCCGTGGGCCAATGGGAGAGCTCTTGTTATTATTAATATTGTTGCCGCTGTT GTGTTGTTGTTATTAATTAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001005376 |
Insert Size | 1400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001005376.1, NP_001005376.1 |
RefSeq Size | 1437 bp |
RefSeq ORF | 846 bp |
Locus ID | 5329 |
UniProt ID | Q03405 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Complement and coagulation cascades |
Gene Summary | This gene encodes the receptor for urokinase plasminogen activator and, given its role in localizing and promoting plasmin formation, likely influences many normal and pathological processes related to cell-surface plasminogen activation and localized degradation of the extracellular matrix. It binds both the proprotein and mature forms of urokinase plasminogen activator and permits the activation of the receptor-bound pro-enzyme by plasmin. The protein lacks transmembrane or cytoplasmic domains and may be anchored to the plasma membrane by a glycosyl-phosphatidylinositol (GPI) moiety following cleavage of the nascent polypeptide near its carboxy-terminus. However, a soluble protein is also produced in some cell types. Alternative splicing results in multiple transcript variants encoding different isoforms. The proprotein experiences several post-translational cleavage reactions that have not yet been fully defined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) has multiple differences in the coding region, compared to variant 1. Variant 2 encodes the shortest isoform (2), also called suPLAUR, which is the soluble form of this protein. Isoform 2 lacks one of three LU (Ly-6 antigen/uPA receptor-like) domains, compared to isoform 1. |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
Involvement of nitric oxide synthase in matrix metalloproteinase-9- and/or urokinase plasminogen activator receptor-mediated glioma cell migration
,Zhuang, T;Chelluboina, B;Ponnala, S;Velpula, KK;Rehman, AA;Chetty, C;Zakharian, E;Rao, JS;Veeravalli, KK;,
BMC Cancer Dec 2013.
,PubMed ID 24325546
[PLAUR]
|
siRNA-Mediated Downregulation of MMP-9 and uPAR in Combination with Radiation Induces G2/M Cell-Cycle Arrest in Medulloblastoma
,Purna Chandra Nagaraju Ganji, Arun Kumar Nalla, Reshu Gupta, Sanjeeva Mohanam, Meena Gujrati, Dzung H. Dinh, and Jasti S. Rao,
Mol. Cancer Res., Jan 2011; 9: 51 - 66
[PLAUR]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217929 | PLAUR (Myc-DDK-tagged)-Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 2 |
CNY 2400.00 |
|
RC217929L1 | Lenti ORF clone of Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 2, Myc-DDK-tagged |
CNY 4800.00 |
|
RC217929L2 | Lenti ORF clone of Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RC217929L3 | Lenti ORF clone of Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC217929L4 | Lenti ORF clone of Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG217929 | PLAUR (tGFP-tagged) - Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 2 |
CNY 4370.00 |