LIN28B (NM_001004317) Human Untagged Clone
CAT＃: SC300636
LIN28B (untagged)-Human lin-28 homolog B (C. elegans) (LIN28B)
CNY 3600.00
| Cited in 3 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CSDD2 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001004317 edited
ATGGCCGAAGGCGGGGCTAGCAAAGGTGGTGGAGAAGAGCCCGGGAAGCTGCCGGAGCCG GCAGAGGAGGAATCCCAGGTTTTGCGCGGAACTGGCCACTGTAAGTGGTTCAATGTGCGC ATGGGATTTGGATTCATCTCCATGATAAACCGAGAGGGAAGCCCCTTGGATATTCCAGTC GATGTATTTGTACACCAAAGCAAACTATTCATGGAAGGATTTAGAAGCCTAAAAGAAGGA GAACCAGTGGAATTCACATTTAAAAAATCTTCCAAAGGCCTTGAGTCAATACGGGTAACA GGACCTGGTGGGAGCCCCTGTTTAGGAAGTGAAAGAAGACCCAAAGGGAAGACACTACAG AAAAGAAAACCAAAGGGAGATAGATGCTACAACTGTGGTGGCCTTGATCATCATGCTAAG GAATGTAGTCTACCTCCTCAGCCAAAGAAGTGCCATTACTGTCAGAGCATCATGCACATG GTGGCAAACTGCCCACATAAAAATGTTGCACAGCCACCCGCGAGTTCTCAGGGAAGACAG GAAGCAGAATCCCAGCCATGCACTTCAACTCTCCCTCGAGAAGTGGGAGGCGGGCATGGC TGTACATCACCACCGTTTCCTCAGGAGGCTAGGGCAGAGATCTCAGAACGGTCAGGCAGG TCACCTCAAGAAGCTTCCTCCACGAAGTCATCTATAGCACCAGAAGAGCAAAGCAAAAAG GGGCCTTCAGTTCAAAAAAGGAAAAAGACATAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001004317 |
| Insert Size | 2900 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001004317.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001004317.2, NP_001004317.1 |
| RefSeq Size | 5504 bp |
| RefSeq ORF | 753 bp |
| Locus ID | 389421 |
| UniProt ID | Q6ZN17 |
| Gene Summary | The protein encoded by this gene belongs to the lin-28 family, which is characterized by the presence of a cold-shock domain and a pair of CCHC zinc finger domains. This gene is highly expressed in testis, fetal liver, placenta, and in primary human tumors and cancer cell lines. It is negatively regulated by microRNAs that target sites in the 3' UTR, and overexpression of this gene in primary tumors is linked to the repression of let-7 family of microRNAs and derepression of let-7 targets, which facilitates cellular transformation. [provided by RefSeq, Jun 2012] |
Citations (3)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Structural insights of the pre-let-7 interaction with LIN28B
,null,
Nucleosides, Nucleotides Nucleic Acids
,PubMed ID 33319653
[LIN28B]
|
|
Sirtuin 6 inhibits colon cancer progression by modulating PTEN/AKT signaling
,Tian, J;Yuan, L;,
Biomed. Pharmacother.
,PubMed ID 29957460
[LIN28B]
|
|
LIN28B promotes the progression of colon cancer by increasing B-cell lymphoma 2 expression
,Yuan, L;Tian, J;,
Biomed. Pharmacother.
,PubMed ID 29669301
[LIN28B]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213537 | LIN28B (Myc-DDK-tagged)-Human lin-28 homolog B (C. elegans) (LIN28B) |
CNY 3600.00 |
|
| RC213537L1 | Lenti ORF clone of Human lin-28 homolog B (C. elegans) (LIN28B), Myc-DDK-tagged |
CNY 6000.00 |
|
| RC213537L2 | Lenti ORF clone of Human lin-28 homolog B (C. elegans) (LIN28B), mGFP tagged |
CNY 6000.00 |
|
| RC213537L3 | Lenti ORF clone of Human lin-28 homolog B (C. elegans) (LIN28B), Myc-DDK-tagged |
CNY 6000.00 |
|
| RC213537L4 | Lenti ORF clone of Human lin-28 homolog B (C. elegans) (LIN28B), mGFP tagged |
CNY 6000.00 |
|
| RG213537 | LIN28B (tGFP-tagged) - Human lin-28 homolog B (C. elegans) (LIN28B) |
CNY 5200.00 |
