CD200 (NM_001004196) Human Untagged Clone
CAT#: SC300613
CD200 (untagged)-Human CD200 molecule (CD200), transcript variant 2
CNY 2400.00
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MOX1; MOX2; MRC; OX-2 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001004196 edited
ATGGAGAGGCTGACTCTGACCAGGACAATTGGGGGCCCTCTCCTTACAGCTACACTCCTA GGAAAGACCACCATCAATGATTACCAGGTGATCAGGATGCCCTTCTGTCATCTGTCTACC TACAGCCTGGTTTGGGTCATGGCAGCAGTGGTGCTGTGCACAGCACAAGTGCAAGTGGTG ACCCAGGATGAAAGAGAGCAGCTGTACACACCTGCTTCCTTAAAATGCTCTCTGCAAAAT GCCCAGGAAGCCCTCATTGTGACATGGCAGAAAAAGAAAGCTGTAAGCCCAGAAAACATG GTCACCTTCAGCGAGAACCATGGGGTGGTGATCCAGCCTGCCTATAAGGACAAGATAAAC ATTACCCAGCTGGGACTCCAAAACTCAACCATCACCTTCTGGAATATCACCCTGGAGGAT GAAGGGTGTTACATGTGTCTCTTCAATACCTTTGGTTTTGGGAAGATCTCAGGAACGGCC TGCCTCACCGTCTATGTACAGCCCATAGTATCCCTTCACTACAAATTCTCTGAAGACCAC CTAAATATCACTTGCTCTGCCACTGCCCGCCCAGCCCCCATGGTCTTCTGGAAGGTCCCT CGGTCAGGGATTGAAAATAGTACAGTGACTCTGTCTCACCCAAATGGGACCACGTCTGTT ACCAGCATCCTCCATATCAAAGACCCTAAGAATCAGGTGGGGAAGGAGGTGATCTGCCAG GTGCTGCACCTGGGGACTGTGACCGACTTTAAGCAAACCGTCAACAAAGGCTATTGGTTT TCAGTTCCGCTATTGCTAAGCATTGTTTCCCTGGTAATTCTTCTCGTCCTAATCTCAATC TTACTGTACTGGAAACGTCACCGGAATCAGGACCGAGAGCCCTAA |
Restriction Sites | Please inquire |
ACCN | NM_001004196 |
Insert Size | 2500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001004196.1, NP_001004196.1 |
RefSeq Size | 2247 bp |
RefSeq ORF | 885 bp |
Locus ID | 4345 |
UniProt ID | P41217 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a type I membrane glycoprotein containing two extracellular immunoglobulin domains, a transmembrane and a cytoplasmic domain. This gene is expressed by various cell types, including B cells, a subset of T cells, thymocytes, endothelial cells, and neurons. The encoded protein plays an important role in immunosuppression and regulation of anti-tumor activity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (2) includes an alternate in-frame exon in the 5' coding region, compared to variant 1, that results in an isoform (b) with a longer N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217941 | CD200 (Myc-DDK-tagged)-Human CD200 molecule (CD200), transcript variant 2 |
CNY 2400.00 |
|
RC217941L1 | Lenti ORF clone of Human CD200 molecule (CD200), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC217941L2 | Lenti ORF clone of Human CD200 molecule (CD200), transcript variant 2, mGFP tagged |
CNY 4800.00 |
|
RC217941L3 | Lenti ORF clone of Human CD200 molecule (CD200), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC217941L4 | Lenti ORF clone of Human CD200 molecule (CD200), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG217941 | CD200 (tGFP-tagged) - Human CD200 molecule (CD200), transcript variant 2 |
CNY 4000.00 |