Annexin A13 (ANXA13) (NM_001003954) Human Untagged Clone
CAT#: SC300584
ANXA13 (untagged)-Human annexin A13 (ANXA13), transcript variant 2
CNY 5800.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ANX13; ISA |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001003954, the custom clone sequence may differ by one or more nucleotides
ATGGGCAATCGTCATAGCCAGTCGTACACCCTCTCAGAAGGCAGTCAACAGTTGCCTAAA GGGGACTCCCAACCCTCGACAGTCGTGCAGCCTCTCAGCCACCCATCACGGAATGGAGAG CCAGAGGCCCCACAGCCTGCTAAAGCGAGCAGTCCTCAGGGTTTTGATGTGGATCGAGAT GCCAAAAAGCTGAACAAAGCCTGCAAAGGAATGGGGACCAATGAAGCAGCCATCATTGAA ATCTTATCGGGCAGGACATCAGATGAGAGGCAACAAATCAAGCAAAAGTACAAGGCAACG TACGGCAAGGAGCTGGAGGAAGTACTCAAGAGTGAGCTGAGTGGAAACTTCGAGAAGACA GCGTTGGCCCTTCTGGACCGTCCCAGCGAGTACGCCGCCCGGCAGCTGCAGAAGGCTATG AAGGGTCTGGGCACAGATGAGTCCGTCCTCATTGAGGTCCTGTGCACGAGGACCAATAAG GAAATCATCGCCATTAAAGAGGCCTACCAAAGGCTATTTGATAGGAGCCTCGAATCAGAT GTCAAAGGTGATACAAGTGGAAACCTAAAAAAAATCCTGGTGTCTCTGCTGCAGGCTAAT CGCAATGAAGGAGATGACGTGGACAAAGATCTAGCTGGTCAGGATGCCAAAGATCTGTAT GATGCAGGGGAAGGCCGCTGGGGCACTGATGAGCTTGCGTTCAATGAAGTCCTGGCCAAG AGGAGCTACAAGCAGTTACGAGCCACCTTTCAAGCCTATCAAATTCTCATTGGCAAAGAC ATAGAAGAAGCCATTGAAGAAGAAACATCAGGCGACTTGCAGAAGGCCTATTTAACTCTC GTGAGATGTGCCCAGGATTGTGAGGACTATTTTGCTGAACGTCTGTACAAGTCGATGAAG GGTGCGGGGACCGATGAGGAGACGTTGATTCGCATAGTCGTGACCAGGGCCGAGGTGGAC CTTCAGGGGATCAAAGCAAAGTTCCAAGAGAAGTATCAGAAGTCTCTCTCTGACATGGTT CGCTCAGATACCTCCGGGGACTTCCGGAAACTGCTAGTAGCCCTCTTGCACTGA |
Restriction Sites | Please inquire |
ACCN | NM_001003954 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001003954.1, NP_001003954.1 |
RefSeq Size | 1609 bp |
RefSeq ORF | 1074 bp |
Locus ID | 312 |
UniProt ID | P27216 |
Gene Summary | This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. The specific function of this gene has not yet been determined; however, it is associated with the plasma membrane of undifferentiated, proliferating endothelial cells and differentiated villus enterocytes. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) contains an additional segment in the coding region, compared to variant 1. The resulting isoform (b) is longer, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215571 | ANXA13 (Myc-DDK-tagged)-Human annexin A13 (ANXA13), transcript variant 2 |
CNY 5488.00 |
|
RC215571L3 | Lenti ORF clone of Human annexin A13 (ANXA13), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC215571L4 | Lenti ORF clone of Human annexin A13 (ANXA13), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG215571 | ANXA13 (tGFP-tagged) - Human annexin A13 (ANXA13), transcript variant 2 |
CNY 7088.00 |
其它Annexin A13产品