RABL2B (NM_001003789) Human Untagged Clone
CAT#: SC300543
RABL2B (untagged)-Human RAB, member of RAS oncogene family-like 2B (RABL2B), transcript variant 1
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001003789, the custom clone sequence may differ by one or more nucleotides
ATGGCAGAAGACAAAACCAAACCGAGTGAGTTGGACCAAGGGAAGTATGATGCTGATGAC AACGTGAAGATCATCTGCCTGGGAGACAGCGCAGTGGGCAAATCCAAACTCATGGAGAGA TTTCTCATGGATGGCTTTCAGCCACAGCAGCTGTCCACGTACGCCCTGACCCTGTACAAG CACACAGCCACGGTAGATGGAAGGACCATCCTTGTGGACTTTTGGGACACGGCAGGCCAG GAGCGGTTCCAGAGCATGCATGCCTCCTACTACCACAAGGCCCACGCCTGCATCATGGTG TTTGATGTACAGAGGAAAGTCACCTATAGGAACCTGAGCACCTGGTATACAGAGCTTCGG GAGTTCAGGCCAGAGATCCCATGCATCGTGGTGGCCAATAAAATTGATGCAGACATAAAC GTGACCCAAAAAAGCTTCAATTTTGCCAAGAAGTTCTCCCTGCCCCTGTATTTCGTCTCG GCTGCTGATGGTACCAATGTTGTGAAGCTCTTCAATGATGCAATTCGATTAGCTGTGTCT TACAAACAGAACTCCCAGGACTTCATGGATGAGATTTTTCAGGAGCTCGAGAACTTCAGC TTGGAGCAGGAAGAGGAGGACGTGCCAGACCAGGAACAGAGCAGCAGCATCGAGACCCCA TCAGAGGAGGCGGCCTCTCCCCACAGCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001003789 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001003789.1, NP_001003789.1 |
RefSeq Size | 2190 bp |
RefSeq ORF | 690 bp |
Locus ID | 11158 |
UniProt ID | Q9UNT1 |
Protein Families | Druggable Genome |
Gene Summary | The RABL2B protein is a member of the RAB gene family which belongs to the RAS GTPase superfamily. RABL2B is located within a subtelomeric region of 22q13.3. Multiple alternatively spliced transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2008] Transcript Variant: This variant (1) has multiple differences in the 5' UTR and coding sequence compared to variant 7. The resulting isoform (1) has the same N- and C-termini but is shorter compared to isoform 3. Variants 1, 3, 4, and 5 all encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213570 | RABL2B (Myc-DDK-tagged)-Human RAB, member of RAS oncogene family-like 2B (RABL2B), transcript variant 1 |
CNY 3990.00 |
|
RC213570L3 | Lenti-ORF clone of RABL2B (Myc-DDK-tagged)-Human RAB, member of RAS oncogene family-like 2B (RABL2B), transcript variant 1 |
CNY 5890.00 |
|
RC213570L4 | Lenti-ORF clone of RABL2B (mGFP-tagged)-Human RAB, member of RAS oncogene family-like 2B (RABL2B), transcript variant 1 |
CNY 5890.00 |
|
RG213570 | RABL2B (tGFP-tagged) - Human RAB, member of RAS oncogene family-like 2B (RABL2B), transcript variant 1 |
CNY 4370.00 |