PPAR alpha (PPARA) (NM_001001928) Human Untagged Clone

CAT#: SC300346

PPARA (untagged)-Human peroxisome proliferator-activated receptor alpha (PPARA), transcript variant 3



  "NM_001001928" in other vectors (4)

CNY 7410.00


货期*
2周

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (3)
PPARA (PPAR alpha) mouse monoclonal antibody, clone OTI1E8 (formerly 1E8)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hPPAR; NR1C1; PPAR; PPAR-alpha; PPARalpha
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_005036 edited
ATGGTGGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAG
AGCCCGTTATCTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAGATTTCGCAATCC
ATCGGCGAGGATAGTTCTGGAAGCTTTGGCTTTACGGAATACCAGTATTTAGGAAGCTGT
CCTGGCTCAGATGGCTCGGTCATCACGGACACGCTTTCACCAGCTTCGAGCCCCTCCTCG
GTGACTTATCCTGTGGTCCCCGGCAGCGTGGACGAGTCTCCCAGTGGAGCATTGAACATC
GAATGTAGAATCTGCGGGGACAAGGCCTCAGGCTATCATTACGGAGTCCACGCGTGTGAA
GGCTGCAAGGGCTTCTTTCGGCGAACGATTCGACTCAAGCTGGTGTATGACAAGTGCGAC
CGCAGCTGCAAGATCCAGAAAAAGAACAGAAACAAATGCCAGTATTGTCGATTTCACAAG
TGCCTTTCTGTCGGGATGTCACACAACGCGATTCGTTTTGGACGAATGCCAAGATCTGAG
AAAGCAAAACTGAAAGCAGAAATTCTTACCTGTGAACATGACATAGAAGATTCTGAAACT
GCAGATCTCAAATCTCTGGCCAAGAGAATCTACGAGGCCTACTTGAAGAACTTCAACATG
AACAAGGTCAAAGCCCGGGTCATCCTCTCAGGAAAGGCCAGTAACAATCCACCTTTTGTC
ATACATGATATGGAGACACTGTGTATGGCTGAGAAGACGCTGGTGGCCAAGCTGGTGGCC
AATGGCATCCAGAACAAGGAGGCGGAGGTCCGCATCTTTCACTGCTGCCAGTGCACGTCA
GTGGAGACCGTCACGGAGCTCACGGAATTCGCCAAGGCCATCCCAGGCTTCGCAAACTTG
GACCTGAACGATCAAGTGACATTGCTAAAATACGGAGTTTATGAGGCCATATTCGCCATG
CTGTCTTCTGTGATGAACAAAGACGGGATGCTGGTAGCGTATGGAAATGGGTTTATAACT
CGTGAATTCCTAAAAAGCCTAAGGAAACCGTTCTGTGATATCATGGAACCCAAGTTTGAT
TTTGCCATGAAGTTCAATGCACTGGAACTGGATGACAGTGATATCTCCCTTTTTGTGGCT
GCTATCATTTGCTGTGGAGATCGTCCTGGCCTTCTAAACGTAGGACACATTGAAAAAATG
CAGGAGGGTATTGTACATGTGCTCAGACTCCACCTGCAGAGCAACCACCCGGACGATATC
TTTCTCTTCCCAAAACTTCTTCAAAAAATGGCAGACCTCCGGCAGCTGGTGACGGAGCAT
GCGCAGCTGGTGCAGATCATCAAGAAGACGGAGTCGGATGCTGCGCTGCACCCGCTACTG
CAGGAGATCTACAGGGACATGTACTGA
Restriction Sites Please inquire     
ACCN NM_001001928
Insert Size 1400 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001001928.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001001928.2, NP_001001928.1
RefSeq Size 9965 bp
RefSeq ORF 1407 bp
Locus ID 5465
UniProt ID Q07869
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
Protein Pathways Adipocytokine signaling pathway, PPAR signaling pathway
Gene Summary Peroxisome proliferators include hypolipidemic drugs, herbicides, leukotriene antagonists, and plasticizers; this term arises because they induce an increase in the size and number of peroxisomes. Peroxisomes are subcellular organelles found in plants and animals that contain enzymes for respiration and for cholesterol and lipid metabolism. The action of peroxisome proliferators is thought to be mediated via specific receptors, called PPARs, which belong to the steroid hormone receptor superfamily. PPARs affect the expression of target genes involved in cell proliferation, cell differentiation and in immune and inflammation responses. Three closely related subtypes (alpha, beta/delta, and gamma) have been identified. This gene encodes the subtype PPAR-alpha, which is a nuclear transcription factor. Multiple alternatively spliced transcript variants have been described for this gene, although the full-length nature of only two has been determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 5. Variants 3 and 5 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...