CD44 (NM_001001390) Human Untagged Clone
CAT#: SC300173
CD44 (untagged)-Human CD44 molecule (Indian blood group) (CD44), transcript variant 3
CNY 3656.00
CNY 7890.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CDW44; CSPG8; ECMR-III; HCELL; HUTCH-I; IN; LHR; MC56; MDU2; MDU3; MIC4; Pgp1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001001390 edited
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCG CAGATCGATTTGAATATAACCTGCCGCTTTGCAGGTGTATTCCACGTGGAGAAAAATGGT CGCTACAGCATCTCTCGGACGGAGGCCGCTGACCTCTGCAAGGCTTTCAATAGCACCTTG CCCACAATGGCCCAGATGGAGAAAGCTCTGAGCATCGGATTTGAGACCTGCAGGTATGGG TTCATAGAAGGGCACGTGGTGATTCCCCGGATCCACCCCAACTCCATCTGTGCAGCAAAC AACACAGGGGTGTACATCCTCACATCCAACACCTCCCAGTATGACACATATTGCTTCAAT GCTTCAGCTCCACCTGAAGAAGATTGTACATCAGTCACAGACCTGCCCAATGCCTTTGAT GGACCAATTACCATAACTATTGTTAACCGTGATGGCACCCGCTATGTCCAGAAAGGAGAA TACAGAACGAATCCTGAAGACATCTACCCCAGCAACCCTACTGATGATGACGTGAGCAGC GGCTCCTCCAGTGAAAGGAGCAGCACTTCAGGAGGTTACATCTTTTACACCTTTTCTACT GTACACCCCATCCCAGACGAAGACAGTCCCTGGATCACCGACAGCACAGACAGAATCCCT GCTACCAATATGGACTCCAGTCATAGTATAACGCTTCAGCCTACTGCAAATCCAAACACA GGTTTGGTGGAAGATTTGGACAGGACAGGACCTCTTTCAATGACAACGCAGCAGAGTAAT TCTCAGAGCTTCTCTACATCACATGAAGGCTTGGAAGAAGATAAAGACCATCCAACAACT TCTACTCTGACATCAAGCAATAGGAATGATGTCACAGGTGGAAGAAGAGACCCAAATCAT TCTGAAGGCTCAACTACTTTACTGGAAGGTTATACCTCTCATTACCCACACACGAAGGAA AGCAGGACCTTCATCCCAGTGACCTCAGCTAAGACTGGGTCCTTTGGAGTTACTGCAGTT ACTGTTGGAGATTCCAACTCTAATGTCAATCGTTCCTTATCAGGAGACCAAGACACATTC CACCCCAGTGGGGGGTCCCATACCACTCATGGATCTGAATCAGATGGACACTCACATGGG AGTCAAGAAGGTGGAGCAAACACAACCTCTGGTCCTATAAGGACACCCCAAATTCCAGAA TGGCTGATCATCTTGGCATCCCTCTTGGCCTTGGCTTTGATTCTTGCAGTTTGCATTGCA GTCAACAGTCGAAGAAGGTGTGGGCAGAAGAAAAAGCTAGTGATCAACAGTGGCAATGGA GCTGTGGAGGACAGAAAGCCAAGTGGACTCAACGGAGAGGCCAGCAAGTCTCAGGAAATG GTGCATTTGGTGAACAAGGAGTCGTCAGAAACTCCAGACCAGTTTATGACAGCTGATGAG ACAAGGAACCTGCAGAATGTGGACATGAAGATTGGGGTGTAA |
Restriction Sites | Please inquire |
ACCN | NM_001001390 |
Insert Size | 3100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001001390.1, NP_001001390.1 |
RefSeq Size | 5001 bp |
RefSeq ORF | 1482 bp |
Locus ID | 960 |
UniProt ID | P16070 |
Protein Families | Adult stem cells, Cancer stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Stem cell relevant signaling - DSL/Notch pathway, Transmembrane |
Protein Pathways | ECM-receptor interaction, Hematopoietic cell lineage |
Gene Summary | The protein encoded by this gene is a cell-surface glycoprotein involved in cell-cell interactions, cell adhesion and migration. It is a receptor for hyaluronic acid (HA) and can also interact with other ligands, such as osteopontin, collagens, and matrix metalloproteinases (MMPs). This protein participates in a wide variety of cellular functions including lymphocyte activation, recirculation and homing, hematopoiesis, and tumor metastasis. Transcripts for this gene undergo complex alternative splicing that results in many functionally distinct isoforms, however, the full length nature of some of these variants has not been determined. Alternative splicing is the basis for the structural and functional diversity of this protein, and may be related to tumor metastasis. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3), also known as CD44R, lacks multiple coding-exons compared to variant 1. The translation remains in-frame. The resulting isoform (3) lacks an internal segment, as compared to isoform 1. Sequence Note: This RefSeq record represents the CD44*001.1.1 allele. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212616 | CD44 (Myc-DDK-tagged)-Human CD44 molecule (Indian blood group) (CD44), transcript variant 3 |
CNY 5488.00 |
|
RC212616L1 | Lenti ORF clone of Human CD44 molecule (Indian blood group) (CD44), transcript variant 3, Myc-DDK-tagged |
CNY 7888.00 |
|
RC212616L2 | Lenti ORF clone of Human CD44 molecule (Indian blood group) (CD44), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
RC212616L3 | Lenti ORF clone of Human CD44 molecule (Indian blood group) (CD44), transcript variant 3, Myc-DDK-tagged |
CNY 5890.00 |
|
RC212616L4 | Lenti ORF clone of Human CD44 molecule (Indian blood group) (CD44), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
RG212616 | CD44 (tGFP-tagged) - Human CD44 molecule (Indian blood group) (CD44), transcript variant 3 |
CNY 7088.00 |