IL5 (NM_000879) Human Untagged Clone
CAT#: SC300144
IL5 (untagged)-Human interleukin 5 (colony-stimulating factor, eosinophil) (IL5)
CNY 1,200.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | EDF; IL-5; TRF |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_000879 edited
CAAACGCAGAACGTTTCAGAGCCATGAGGATGCTTCTGCATTTGAGTTTGCTAGCTCTTG GAGCTGCCTACGTGTATGCCATCCCCACAGAAATTCCCACAAGTGCATTGGTGAAAGAGA CCTTGGCACTGCTTTCTACTCATCGAACTCTGCTGATAGCCAATGAGACTCTGAGGATTC CTGTTCCTGTACATAAAAATCACCAACTGTGCACTGAAGAAATCTTTCAGGGAATAGGCA CACTGGAGAGTCAAACTGTGCAAGGGGGTACTGTGGAAAGACTATTCAAAAACTTGTCCT TAATAAAGAAATACATTGACGGCCAAAAAAAAAAGTGTGGAGAAGAAAGACGGAGAGTAA ACCAATTCCTAGACTACCTGCAAGAGTTTCTTGGTGTAATGAACACCGAGTGGATAATAG AAAGTTGAGACTAAACTGGTTGTTGCAGCCAAAGAT |
Restriction Sites | Please inquire |
ACCN | NM_000879 |
Insert Size | 500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000879.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000879.2, NP_000870.1 |
RefSeq Size | 816 bp |
RefSeq ORF | 405 bp |
Locus ID | 3567 |
UniProt ID | P05113 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Allograft rejection, Asthma, Autoimmune thyroid disease, Cytokine-cytokine receptor interaction, Fc epsilon RI signaling pathway, Hematopoietic cell lineage, Jak-STAT signaling pathway, T cell receptor signaling pathway |
Gene Summary | This gene encodes a cytokine that acts as a growth and differentiation factor for both B cells and eosinophils. The encoded cytokine plays a major role in the regulation of eosinophil formation, maturation, recruitment and survival. The increased production of this cytokine may be related to pathogenesis of eosinophil-dependent inflammatory diseases. This cytokine functions by binding to its receptor, which is a heterodimer, whose beta subunit is shared with the receptors for interleukine 3 (IL3) and colony stimulating factor 2 (CSF2/GM-CSF). This gene is located on chromosome 5 within a cytokine gene cluster which includes interleukin 4 (IL4), interleukin 13 (IL13), and CSF2 . This gene, IL4, and IL13 may be regulated coordinately by long-range regulatory elements spread over 120 kilobases on chromosome 5q31. [provided by RefSeq, Jul 2013] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209681 | IL5 (Myc-DDK-tagged)-Human interleukin 5 (colony-stimulating factor, eosinophil) (IL5) |
CNY 1,200.00 |
|
RC209681L3 | Lenti ORF clone of Human interleukin 5 (colony-stimulating factor, eosinophil) (IL5), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC209681L4 | Lenti ORF clone of Human interleukin 5 (colony-stimulating factor, eosinophil) (IL5), mGFP tagged |
CNY 5,890.00 |
|
RG209681 | IL5 (tGFP-tagged) - Human interleukin 5 (colony-stimulating factor, eosinophil) (IL5) |
CNY 2,800.00 |