IL10 (NM_000572) Human Untagged Clone
CAT#: SC300099
IL10 (untagged)-Human interleukin 10 (IL10)
CNY 2400.00
CNY 3990.00
| Cited in 4 publications. | 
Product images
 
                    
                Specifications
| Product Data | |
| Type | Human Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | CSIF; GVHDS; IL-10; IL10A; TGIF | 
| Vector | pCMV6-XL5 | 
| E. coli Selection | Ampicillin (100 ug/mL) | 
| Mammalian Cell Selection | None | 
| Sequence Data | >OriGene sequence for NM_000572 edited CTTGCAAAACCAAACCACAAGACAGACTTGCAAAAGAAGGCATGCACAGCTCAGCACTGC TCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGCCAGCCCAGGCCAGGGCACCCAGTCTG AGAACAGCTGCACCCACTTCCCAGGCAACCTGCCTAACATGCTTCGAGATCTCCGAGATG CCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGGATCAGCTGGACAACTTGTTGTTAA AGGAGTCCTTGCTGGAGGACTTTAAGGGTTACCTGGGTTGCCAAGCCTTGTCTGAGATGA TCCAGTTTTACCTGGAGGAGGTGATGCCCCAAGCTGAGAACCAAGACCCAGACATCAAGG CGCATGTGAACTCCCTGGGGGAGAACCTGAAGACCCTCAGGCTGAGGCTACGGCGCTGTC ATCGATTTCTTCCCTGTGAAAACAAGAGCAAGGCCGTGGAGCAGGTGAAGAATGCCTTTA ATAAGCTCCAAGAGAAAGGCATCTACAAAGCCATGAGTGAGTTTGACATCTTCATCAACT ACATAGAAGCCTACATGACAATGAAGATACGAAACTGAGACATCAGGGTGGCGACTCTAT AGA | 
| Restriction Sites | Please inquire | 
| ACCN | NM_000572 | 
| Insert Size | 537 bp | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. | 
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_000572.2, NP_000563.1 | 
| RefSeq Size | 1629 bp | 
| RefSeq ORF | 537 bp | 
| Locus ID | 3586 | 
| UniProt ID | P22301 | 
| Domains | IL10 | 
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein | 
| Protein Pathways | Allograft rejection, Asthma, Autoimmune thyroid disease, Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, Systemic lupus erythematosus, T cell receptor signaling pathway | 
| Gene Summary | The protein encoded by this gene is a cytokine produced primarily by monocytes and to a lesser extent by lymphocytes. This cytokine has pleiotropic effects in immunoregulation and inflammation. It down-regulates the expression of Th1 cytokines, MHC class II Ags, and costimulatory molecules on macrophages. It also enhances B cell survival, proliferation, and antibody production. This cytokine can block NF-kappa B activity, and is involved in the regulation of the JAK-STAT signaling pathway. Knockout studies in mice suggested the function of this cytokine as an essential immunoregulator in the intestinal tract. Mutations in this gene are associated with an increased susceptibility to HIV-1 infection and rheumatoid arthritis. [provided by RefSeq, May 2020] | 
Citations (4)
| The use of this cDNA Clones has been cited in the following citations: | 
|---|
| Modulating Inflammation in Cutaneous Chronic Wounds by Interleukin-10 Release from Collagen-Silica Nanocomposites via Gene Delivery
                                                ,Wang, X;Coradin, T;Helary, C;,
                                                Biomaterials Science
                                                ,PubMed ID 29337327
                                                [IL10] | 
| Co-transfection of decorin and interleukin-10 modulates pro-fibrotic extracellular matrix gene expression in human tenocyte culture
                                                ,null,
                                                Scientific Reports
                                                ,PubMed ID 26860065
                                                [IL10] | 
| Interleukin-10 chimeric protein to protect transplanted neural progenitor cells from immune responses.
                                                ,null,
                                                Journal of materials chemistry. B
                                                ,PubMed ID 32262218
                                                [IL10] | 
| Interleukin-10 chimeric protein to protect transplanted neural progenitor cells from immune responses
                                                ,Nakaji-Hirabayashi, T;Kitano, H;,
                                                Journal of Materials Chemistry B
                                                
                                                [IL10] | 
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| RC216785 | IL10 (Myc-DDK-tagged)-Human interleukin 10 (IL10) | 
                                                        
                                                        
                                                        
                                                            CNY 3600.00 | |
| RC216785L1 | Lenti ORF clone of Human interleukin 10 (IL10), Myc-DDK-tagged | CNY 6000.00 | |
| RC216785L2 | Lenti ORF clone of Human interleukin 10 (IL10), mGFP tagged | CNY 6000.00 | |
| RC216785L3 | Lenti ORF clone of Human interleukin 10 (IL10), Myc-DDK-tagged | CNY 6000.00 | |
| RC216785L4 | Lenti ORF clone of Human interleukin 10 (IL10), mGFP tagged | CNY 6000.00 | |
| RG216785 | IL10 (tGFP-tagged) - Human interleukin 10 (IL10) | CNY 5200.00 | 

 
        