IMP4 (NM_033416) Human Untagged Clone
CAT＃: SC127736
IMP4 (untagged)-Human IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) (IMP4)
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BXDC4 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_033416, the custom clone sequence may differ by one or more nucleotides
ATGCTGCGCCGCGAGGCCCGCCTGCGCCGCGAGTACCTGTACCGCAAGGCCCGGGAGGAGGCGCAGCGCT CAGCCCAGGAGAGGAAGGAGCGGCTGCGGCGCGCGCTGGAAGAAAACCGCCTGATTCCCACTGAGTTACG CCGAGAGGCTCTGGCCTTACAGGGGTCCCTGGAGTTTGATGATGCTGGAGGTGAAGGTGTGACCAGCCAC GTGGATGATGAATACCGATGGGCAGGAGTCGAGGATCCCAAGGTTATGATCACTACCTCCCGAGACCCCA GTTCCCGCCTCAAGATGTTTGCAAAGGAGCTGAAGCTGGTGTTCCCGGGCGCCCAGCGAATGAACCGAGG TCGACATGAAGTGGGGGCACTGGTGCGAGCCTGCAAAGCCAACGGCGTCACCGATCTGCTGGTCGTTCAC GAGCATCGGGGCACACCTGTGGGGCTCATCGTCAGCCACCTGCCCTTTGGTCCTACTGCCTACTTCACGC TGTGCAATGTGGTCATGCGGCATGACATCCCAGACCTGGGCACCATGTCGGAGGCCAAGCCCCACCTCAT CACACACGGCTTCTCCTCCCGCCTGGGCAAGCGGGTCTCTGACATCCTCCGATACCTATTTCCCGTGCCC AAAGATGACAGCCACCGGGTCATCACCTTCGCAAACCAGGACGACTACATATCATTCCGGCACCATGTGT ATAAGAAGACAGACCACCGCAACGTGGAGCTCACTGAGGTCGGGCCCCGCTTTGAGCTGAAGCTGTACAT GATCCGTCTGGGCACGCTGGAGCAGGAGGCCACAGCAGACGTGGAGTGGCGCTGGCACCCTTACACCAAT ACCGCACGCAAGAGAGTCTTCCTGAGCACCGAGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_033416 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_033416.1, NP_219484.1 |
| RefSeq Size | 1074 bp |
| RefSeq ORF | 876 bp |
| Locus ID | 92856 |
| UniProt ID | Q96G21 |
| Domains | Brix |
| Gene Summary | The protein encoded by this gene, along with IMP3 and MPP10, is part of the 60-80S U3 small nucleolar ribonucleoprotein (U3 snoRNP) complex. This complex is necessary for the early cleavage steps of pre-18S ribosomal RNA processing. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (1) encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204015 | IMP4 (Myc-DDK-tagged)-Human IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) (IMP4) |
CNY 2400.00 |
|
| RC204015L3 | Lenti ORF clone of Human IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) (IMP4), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC204015L4 | Lenti ORF clone of Human IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) (IMP4), mGFP tagged |
CNY 5890.00 |
|
| RG204015 | IMP4 (tGFP-tagged) - Human IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) (IMP4) |
CNY 4000.00 |
