MPZL (MPZL1) (NM_003953) Human Untagged Clone
CAT#: SC127691
MPZL1 (untagged)-Human myelin protein zero-like 1 (MPZL1), transcript variant 1
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MPZL1b; PZR; PZR1b; PZRa; PZRb |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_003953, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCGTCCGCCGGAGCCGGGGCGGTGATTGCAGCCCCAGACAGCCGGCGCTGGCTGTGGTCGGTGC TGGCGGCGGCGCTTGGGCTCTTGACAGCTGGAGTATCAGCCTTGGAAGTATATACGCCAAAAGAAATCTT CGTGGCAAATGGTACACAAGGGAAGCTGACCTGCAAGTTCAAGTCTACTAGTACGACTGGCGGGTTGACC TCAGTCTCCTGGAGCTTCCAGCCAGAGGGGGCCGACACTACTGTGTCGTTTTTCCACTACTCCCAAGGGC AAGTGTACCTTGGGAATTATCCACCATTTAAAGACAGAATCAGCTGGGCTGGAGACCTTGACAAGAAAGA TGCATCAATCAACATAGAAAATATGCAGTTTATACACAATGGCACCTATATCTGTGATGTCAAAAACCCT CCTGACATCGTTGTCCAGCCTGGACACATTAGGCTCTATGTCGTAGAAAAAGAGAATTTGCCTGTGTTTC CAGTTTGGGTAGTGGTGGGCATAGTTACTGCTGTGGTCCTAGGTCTCACTCTGCTCATCAGCATGATTCT GGCTGTCCTCTATAGAAGGAAAAACTCTAAACGGGATTACACTGGCTGCAGTACATCAGAGAGTTTGTCA CCAGTTAAGCAGGCTCCTCGGAAGTCCCCCTCCGACACTGAGGGTCTTGTAAAGAGTCTGCCTTCTGGAT CTCACCAGGGCCCAGTCATATATGCACAGTTAGACCACTCCGGCGGACATCACAGTGACAAGATTAACAA GTCAGAGTCTGTGGTGTATGCGGATATCCGAAAGAATTAA |
Restriction Sites | NotI-NotI |
ACCN | NM_003953 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_003953.4, NP_003944.1 |
RefSeq Size | 3898 bp |
RefSeq ORF | 810 bp |
Locus ID | 9019 |
UniProt ID | O95297 |
Domains | IGv, IG |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Cell adhesion molecules (CAMs) |
Gene Summary | Cell surface receptor, which is involved in signal transduction processes. Recruits PTPN11/SHP-2 to the cell membrane and is a putative substrate of PTPN11/SHP-2. Is a major receptor for concanavalin-A (ConA) and is involved in cellular signaling induced by ConA, which probably includes Src family tyrosine-protein kinases. Isoform 3 seems to have a dominant negative role; it blocks tyrosine phosphorylation of MPZL1 induced by ConA. Isoform 1, but not isoform 2 and isoform 3, may be involved in regulation of integrin-mediated cell motility.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203176 | MPZL1 (Myc-DDK-tagged)-Human myelin protein zero-like 1 (MPZL1), transcript variant 1 |
CNY 2400.00 |
|
RC203176L1 | Lenti ORF clone of Human myelin protein zero-like 1 (MPZL1), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
RC203176L2 | Lenti ORF clone of Human myelin protein zero-like 1 (MPZL1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RC203176L3 | Lenti ORF clone of Human myelin protein zero-like 1 (MPZL1), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC203176L4 | Lenti ORF clone of Human myelin protein zero-like 1 (MPZL1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG203176 | MPZL1 (tGFP-tagged) - Human myelin protein zero-like 1 (MPZL1), transcript variant 1 |
CNY 4000.00 |