ENSA (NM_004436) Human Untagged Clone

CAT#: SC127196

ENSA (untagged)-Human endosulfine alpha (ENSA), transcript variant 3



  "NM_004436" in other vectors (6)

CNY 1800.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ENSA rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARPP-19e
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_004436, the custom clone sequence may differ by one or more nucleotides


ATGTCCCAGAAACAAGAAGAAGAGAACCCTGCGGAGGAGACCGGCGAGGAGAAGCAGGACACGCAGGAGA
AAGAAGGTATTCTGCCTGAGAGAGCTGAAGAGGCAAAGCTAAAGGCCAAATACCCAAGCCTAGGACAAAA
GCCTGGAGGCTCCGACTTCCTCATGAAGAGACTCCAGAAAGGGCAAAAGTACTTTGACTCAGGAGACTAC
AACATGGCCAAAGCCAAGATGAAGAATAAGCAGCTGCCAAGTGCAGGACCAGACAAGAACCTGGTGACTG
GTGATCACATCCCCACCCCACAGGATCTGCCCCAGAGAAAGTCCTCGCTCGTCACCAGCAAGCTTGCGGG
TGGCCAAGTTGAATGA


>OriGene 5' read for NM_004436 unedited
GCACGAGGATTTTGACTGAGCAACCCTAGTGACAGGAGCCGAAGCAGCAGCGCAGGTTGT
CCCCGTTTCCCCTCCCCCTTCCCTTCTCCGGTTGCCTTCCCGGGCCCCTTACACTCCACA
GTCCCGGTCCCGCCATGTCCCAGAAACAAGAAGAAGAGAACCCTGCGGAGGAGACCGGCG
AGGAGAAGCAGGACACGCAGGAGAAAGAAGGTATTCTGCCTGAGAGAGCTGAAGAGGCAA
AGCTAAAGGCCAAATACCCAAGCCTAGGACAAAAGCCTGGAGGCTCCGACTTCCTCATGA
AGAGACTCCAGAAAGGGCAAAAGTACTTTGACTCAGGAGACTACAACATGGCCAAAGCCA
AGATGAAGAATAAGCAGCTGCCAAGTGCAGGACCAGACAAGAACCTGGTGACTGGTGATC
ACATCCCCACCCCACAGGATCTGCCCCAGAGAAAGTCCTCGCTCGTCACCAGCAAGCTTG
CGGGTGGCCAAGTTGAATGATGCTGCCCGGGGCTCTGCCAGATCCTGAGACGCTTCCCCT
CCCTGCCCCACCCGGGTCCTGTGCTGGCTCCTGCCCCTTCCTGCTTTTGCAGCCAGGGGT
CAGGAGGTGGCTCGGGTGTGGGCTGGAGAGGCAGAAGCCCTTTCCTGTTGGTGTCCCAGC
ACATGGAGCCCCTTGGGCTGAGCAC
Restriction Sites NotI-NotI     
ACCN NM_004436
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_004436.2, NP_004427.1
RefSeq Size 1252 bp
RefSeq ORF 366 bp
Locus ID 2029
UniProt ID O43768
Domains endosulfine
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene belongs to a highly conserved cAMP-regulated phosphoprotein (ARPP) family. This protein was identified as an endogenous ligand for the sulfonylurea receptor, ABCC8/SUR1. ABCC8 is the regulatory subunit of the ATP-sensitive potassium (KATP) channel, which is located on the plasma membrane of pancreatic beta cells and plays a key role in the control of insulin release from pancreatic beta cells. This protein is thought to be an endogenous regulator of KATP channels. In vitro studies have demonstrated that this protein modulates insulin secretion through the interaction with KATP channel, and this gene has been proposed as a candidate gene for type 2 diabetes. At least eight alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3), also known as alpha endosulfine, lacks an in-frame coding segment compared to variant 1. The resulting isoform (3) lacks an internal region, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...