S100 beta (S100B) (NM_006272) Human Untagged Clone
CAT#: SC127092
S100B (untagged)-Human S100 calcium binding protein B (S100B)
CNY 1800.00
| Cited in 2 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | NEF; S100; S100-B; S100beta |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF within SC127092 sequence for NM_006272 edited (data generated by NextGen Sequencing)
ATGTCTGAGCTGGAGAAGGCCATGGTGGCCCTCATCGACGTTTTCCACCAATATTCTGGA AGGGAGGGAGACAAGCACAAGCTGAAGAAATCCGAACTGAAGGAGCTCATCAACAATGAG CTTTCCCATTTCTTAGAGGAAATCAAAGAGCAGGAGGTTGTGGACAAAGTCATGGAAACA CTGGACAATGATGGAGACGGCGAATGTGACTTCCAGGAATTCATGGCCTTTGTTGCCATG GTTACTACTGCCTGCCACGAGTTCTTTGAACATGAGTGA Clone variation with respect to NM_006272.2 >OriGene 5' read for NM_006272 unedited
ATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGACGCCTGCAGCAAGGAGAC CAGGAAGGGGTGAGACAAGGAAGAGGATGTCTGAGCTGGAGAAAGCCATGGTGGCCCTCA TCGACGTTTTCCACCAATATTCTGGAAGGGAGGGAGACAAGCACAAGCTGAAGAAATCCG AACTGAAGGAGCTCATCAACAATGAGCTTTCCCATTTCTTAGAGGAAATCAAAGAGCAGA GGTTGTGGACAAAGTCATGGAAACACTGGACAATGATGGAGACGGCGAATGTGACTTCCA GGAATTCATGGCCTTTGTTGCCATGGTTACTACTGCCTGCCACGAGTTCTTTGAACATGA GTGAGATTAGAAAGCAGCCAAACCTTTCCTGTACAGAAGACGGTCATGCAAGAAAGCAAC AGCAAGGGCTTGCACCTAGTAGGAGCTGAGCTTCCAGCCCGTGGTGTAGCTAATTAGAAG CTTGATTTGCTTTGTGATTGAAAAATTGAAAACCTCTTTCAAAGGCTGTTTTAACGGCCT GATCATTCTTTCTGTATATTAGCCTGTGTGGGAAGCTGACTGCCCCAGGACCTCTGTTAA CAGACTTAGGGAACAGGGCCTAATGGAAAAAACGGGGACGGGCAGCCGCATGGGCCGGGT AAACCTACCCCGGGAGGGAACCCTGGCTACGAAATACCCCGGGGGCACCTTAAAACTTCA CTACTTTTAAAAACAAGCCTATCCGCATTATTTGGAAAAAAAAAAAAAACTCACCTAAAT GGGGCCCGGTCATAAATGGGTTCTTGAAAAACCCGGGGGGGATTCCCGGAACCCTCCCAT GCCTTCTGCCCCNGGAAATGCCACTCAAGGCCCCCACCTTGCAAAAAAAATAATGCATAT TTGGTGAAA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_006272 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_006272.1, NP_006263.1 |
| RefSeq Size | 1095 bp |
| RefSeq ORF | 279 bp |
| Locus ID | 6285 |
| UniProt ID | P04271 |
| Domains | S_100, EFh |
| Gene Summary | The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21; however, this gene is located at 21q22.3. This protein may function in Neurite extension, proliferation of melanoma cells, stimulation of Ca2+ fluxes, inhibition of PKC-mediated phosphorylation, astrocytosis and axonal proliferation, and inhibition of microtubule assembly. Chromosomal rearrangements and altered expression of this gene have been implicated in several neurological, neoplastic, and other types of diseases, including Alzheimer's disease, Down's syndrome, epilepsy, amyotrophic lateral sclerosis, melanoma, and type I diabetes. [provided by RefSeq, Jul 2008] |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
S100B interacts with the serotonin 5-HT7 receptor to regulate a depressive-like behavior.
,null,
European neuropsychopharmacology : the journal of the European College of Neuropsychopharmacology
,PubMed ID 26499172
[S100B]
|
|
S100B Promotes Glioma Growth through Chemoattraction of Myeloid-Derived Macrophages
,Huaqing Wang, Leying Zhang, Ian Y. Zhang, Xuebo Chen, Anna Da Fonseca, Shihua Wu, Hui Ren, Sam Badie, Sam Sadeghi, Mao Ouyang, Charles D. Warden, and Behnam Badie,
Clin. Cancer Res., Jul 2013; 19: 3764 - 3775.
,PubMed ID 23719262
[S100B]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC200277 | S100B (Myc-DDK-tagged)-Human S100 calcium binding protein B (S100B) |
CNY 1800.00 |
|
| RC200277L1 | Lenti ORF clone of Human S100 calcium binding protein B (S100B), Myc-DDK-tagged |
CNY 4200.00 |
|
| RC200277L2 | Lenti ORF clone of Human S100 calcium binding protein B (S100B), mGFP tagged |
CNY 4200.00 |
|
| RC200277L3 | Lenti ORF clone of Human S100 calcium binding protein B (S100B), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC200277L4 | Lenti ORF clone of Human S100 calcium binding protein B (S100B), mGFP tagged |
CNY 4200.00 |
|
| RG200277 | S100B (tGFP-tagged) - Human S100 calcium binding protein B (S100B) |
CNY 3400.00 |
其它S100 beta产品
