UBE2G2 (NM_182688) Human Untagged Clone

CAT#: SC126784

UBE2G2 (untagged)-Human ubiquitin-conjugating enzyme E2G 2 (UBE2G2), transcript variant 2



  "NM_182688" in other vectors (4)

CNY 1200.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
UBE2G2 mouse monoclonal antibody, clone OTI1B10 (formerly 1B10)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms UBC7
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC126784 sequence for NM_182688 edited (data generated by NextGen Sequencing)
ATGAATGAAGAGAACTTTTTTGAATGGGAGGCATTGATCATGGGCCCAGAAGACACCTGC
TTTGAGTTTGGTGTTTTTCCTGCCATCCTGAGTTTCCCACTTGATTACCCGTTAAGTCCC
CCAAAGATGAGATTTACCTGTGAGATGTTTCATCCCAACATCTACCCTGATGGGAGAGTC
TGCATTTCCATCCTCCACGCGCCAGGCGATGACCCCATGGGCTACGAGAGCAGCGCGGAG
CGGTGGAGTCCTGTGCAGAGTGTGGAGAAGATCCTGCTGTCGGTGGTGAGCATGCTGGCA
GAGCCCAATGACGAAAGTGGAGCTAACGTGGATGCGTCCAAAATGTGGCGCGATGACCGG
GAGCAGTTCTATAAGATTGCCAAGCAGATCGTCCAGAAGTCTCTGGGACTGTGA

Clone variation with respect to NM_182688.2
>OriGene 5' read for NM_182688 unedited
CCCCCCCATACCCCCGCCCGTTGNCGCTTTGGGCGGTAGGCGTGTACGGTGGGAGGTCTA
TATAAGCAGTTCTTATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGC
GGCCGCGAATTCGGCACGAGGCACGCGCGCGGCTGAGGCGAGGTCGCTCGGCGCAGCTGT
TGCGGGGCCATGGCGGGGACCGCGCTCAAGAGGCTGATGGCCGAGTACAAACAATTAACA
CTGAATCCTCCGGAAGGAATTGTAGCAGGCCCCATGAATGAAGAGAACTTTTTTGAATGG
GAGGCATTGATCATGGGCCCAGAAGACACCTGCTTTGAGTTTGGTGTTTTTCCTGCCATC
CTGAGTTTCCCACTTGATTACCCGTTAAGTCCCCCAAAGATGAGATTTACCTGTGAGATG
TTTCATCCCAACATCTACCCTGATGGGAGAGTCTGCATTTCCATCCTCCACGCGCCAGGC
GATGACCCCATGGGCTACGAGAGCAGCGCGGAGCGGTGGAGTCCTGTGCAGAGTGTGGAG
AAGATCCTGCTGTCGGTGGTGAGCATGCTGGCAGAGCCCAATGACGAAAGTGGAGCTAAC
GTGGATGCGTCCAAAATGTGGCGCGATGACCGGGAGCAGTTCTATAAGAGTGCCAAGCAG
ATCGTCCAGAAGTCTCTGGGACTGTGAGACCTGGCCTCGCACAGGCGCACACACACCGCC
AATCAGCTCAGCATTCTCCCCCGGCACACTTAGTGACAGTGATGCTCTGTGCTGGTACCA
AACTAGGCAGACTTGCAAGAACCCGGCATCTTTTTTTTTTTCAACCTTTCTACTTCAACA
GGCTTCTCTTCTGAAAGGAGACTTAATGTCGAATATTGACAACTTACTGCAGTTNTACAG
GA
Restriction Sites NotI-NotI     
ACCN NM_182688
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_182688.1, NP_872630.1
RefSeq Size 3034 bp
RefSeq ORF 414 bp
Locus ID 7327
UniProt ID P60604
Protein Families Druggable Genome
Protein Pathways Parkinson's disease, Ubiquitin mediated proteolysis
Gene Summary The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein shares 100% sequence identity with the mouse counterpart. This gene is ubiquitously expressed, with high expression seen in adult muscle. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (2) has an additional exon in the 5' region, resulting in a downstream AUG start codon, as compared to variant 1. The resulting isoform (2) has a shorter N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...