WDR31 (NM_145241) Human Untagged Clone
CAT＃: SC126615
WDR31 (untagged)-Human WD repeat domain 31 (WDR31), transcript variant 3
CNY 7220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_145241, the custom clone sequence may differ by one or more nucleotides
ATGCTGCTACTCAGGTGCCAACTGAAACAAGCTCCTCCACAGAAGGTTTCGTTTAGGTTTTGTGTCGTGA TGGGGAAACAGCAAAGCAAACTCAAACACAGCACTTATAAATACGGGCCTGATGAAATTATAGAAGAGAG AATTCAAACTAAAGCTTTTCAAGAGTATAGCCCAGCTCACATGGATACCGTCTCTGTCGTGGCTGCTTTG AACTCAGACCTTTGTGTCTCTGGAGGGAAAGATAAGACAGTTGTGGCCTATAATTGGAAAACTGGAAATG TGGTGAAAAGGTTCAAAGGACATGAACATGAGATCACCAAGGTAGCCTGTATTCCCAAATCCAGCCAGTT CTTCAGTGCCTCTCGTGACAGGATGGTCATGATGTGGGACTTGCACGGTTCCTCACAACCAAGGCAGCAA TTGTGTGGCCATGCCATGGTGGTCACCGGATTGGCTGTGAGTCCAGACTCATCACAGCTGTGCACTGGCT CTCGGGACAACACCCTGCTTCTGTGGGATGTGGTGACAGGACAGAGTGTGGAAAGAGCATCTGTCTCCAG GAACGTGGTCACTCACCTGTGCTGGGTCCCCAGAGAACCATACATACTACAGACCTCTGAAGATAAAACC CTCAGATTATGGGACAGTCGGGGGCTGCAGGTAGCTCATATGTTTCCTGCAAAGCAGCACATTCAGACCT ACTGTGAAGTCAGTGTGGATGGACACAAGTGTATCTCCTGCAGCAATGGCTTTGGAGGAGAAGGCTGTGA AGCCACGTTGTGGGACCTAAGACAGACTCGAAACAGAATATGTGAGTATAAGGGGCATTTCCAGACTGTC GCATCCTGCGTCTTTCTACCAAGAGCATTGGCCTTGATGCCTTTAATTGCTACCTCATCACATGATTGCA AGGTGAAGATTTGGAACCAAGATACTGGAGCCTGCCTTTTCACCTTGTCTCTGGATGGATCAGGACCCTT GACTTCTCTGGCTGTTGGTGACGCCATCTCCTTATTGTGTGCAAGTTTTAACAGAGGAATTCACTTACTC AGAATGGACCACAGCCAAGGGCTGGAACTGCAGGAAGTGGCAGCATTCTGA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_145241 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_145241.2, NP_660284.1 |
| RefSeq Size | 2452 bp |
| RefSeq ORF | 1101 bp |
| Locus ID | 114987 |
| UniProt ID | Q8NA23 |
| Domains | WD40 |
| Gene Summary | This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) uses an alternate in-frame splice site in the coding region, compared to variant 1. It encodes isoform 3 which lacks one internal amino acid, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224387 | WDR31 (Myc-DDK-tagged)-Human WD repeat domain 31 (WDR31), transcript variant 3 |
CNY 3656.00 |
|
| RC224387L3 | Lenti ORF clone of Human WD repeat domain 31 (WDR31), transcript variant 3, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC224387L4 | Lenti ORF clone of Human WD repeat domain 31 (WDR31), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
| RG224387 | WDR31 (tGFP-tagged) - Human WD repeat domain 31 (WDR31), transcript variant 3 |
CNY 5256.00 |
