HTRA3 (NM_053044) Human Untagged Clone

CAT#: SC126498

HTRA3 (untagged)-Human HtrA serine peptidase 3 (HTRA3)



  "NM_053044" in other vectors (6)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
Rabbit Polyclonal Anti-HTRA3 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Prsp; Tasp
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_053044, the custom clone sequence may differ by one or more nucleotides


ATGCAGGCGCGAGCGCTGCTCCTGGCCGCGTTGGCCGCGCTGGCGCTGGCCCGGGAGCCCCCTGCGGCGC
CGTGTCCCGCGCGCTGCGACGTGTCGCGGTGTCCCAGCCCCCGCTGCCCCGGCGGCTACGTGCCCGACCT
CTGCAACTGCTGCCTGGTGTGCGCCGCCAGCGAGGGCGAGCCCTGTGGCGGCCCTCTGGACTCGCCTTGC
GGCGAGAGCCTGGAGTGCGTGCGCGGCCTATGCCGCTGCCGCTGGTCGCACGCCGTGTGTGGCACCGACG
GGCACACCTATGCCAACGTGTGCGCGCTGCAGGCGGCCAGCCGCCGCGCGCTGCAGCTCTCCGGGACGCC
CGTGCGCCAGCTGCAGAAGGGCGCCTGCCCGTTGGGTCTCCACCAGCTGAGCAGCCCGCGCTACAAGTTC
AACTTCATTGCTGACGTGGTGGAGAAGATCGCACCAGCCGTGGTCCACATAGAGCTCTTCCTGAGACACC
CGCTGTTTGGCCGCAACGTGCCCCTGTCCAGCGGTTCTGGCTTCATCATGTCAGAGGCCGGCCTGATCAT
CACCAATGCCCACGTGGTGTCCAGCAACAGTGCTGCCCCGGGCAGGCAGCAGCTCAAGGTGCAGCTACAG
AATGGGGACTCCTATGAGGCCACCATCAAAGACATCGACAAGAAGTCGGACATTGCCACCATCAAGATCC
ATCCCAAGAAAAAGCTCCCTGTGTTGTTGCTGGGTCACTCGGCCGACCTGCGGCCTGGGGAGTTTGTGGT
GGCCATCGGCAGTCCCTTCGCCCTACAGAACACAGTGACAACGGGCATCGTCAGCACTGCCCAGCGGGAG
GGCAGGGAGCTGGGCCTCCGGGACTCCGACATGGACTACATCCAGACGGATGCCATCATCAACTACGGGA
ACTCCGGGGGACCACTGGTGAACCTGGATGGCGAGGTCATTGGCATCAACACGCTCAAGGTCACGGCTGG
CATCTCCTTTGCCATCCCCTCAGACCGCATCACACGGTTCCTCACAGAGTTCCAAGACAAGCAGATCAAA
GACTGGAAGAAGCGCTTCATCGGCATACGGATGCGGACGATCACACCAAGCCTGGTGGATGAGCTGAAGG
CCAGCAACCCGGACTTCCCAGAGGTCAGCAGTGGAATTTATGTGCAAGAGGTTGCGCCGAATTCACCTTC
TCAGAGAGGCGGCATCCAAGATGGTGACATCATCGTCAAGGTCAACGGGCGTCCTCTAGTGGACTCGAGT
GAGCTGCAGGAGGCCGTGCTGACCGAGTCTCCTCTCCTACTGGAGGTGCGGCGGGGGAACGACGACCTCC
TCTTCAGCATCGCACCTGAGGTGGTCATGTGA


Restriction Sites Please inquire     
ACCN NM_053044
Insert Size 2700 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_053044.2, NP_444272.1
RefSeq Size 2585 bp
RefSeq ORF 1362 bp
Locus ID 94031
UniProt ID P83110
Domains IB, Tryp_SPc, PDZ, kazal
Protein Families Druggable Genome, Protease, Secreted Protein
Gene Summary Serine protease that cleaves beta-casein/CSN2 as well as several extracellular matrix (ECM) proteoglycans such as decorin/DCN, biglycan/BGN and fibronectin/FN1. Inhibits signaling mediated by TGF-beta family proteins possibly indirectly by degradation of these ECM proteoglycans (By similarity). May act as a tumor suppressor. Negatively regulates, in vitro, trophoblast invasion during placental development and may be involved in the development of the placenta in vivo. May also have a role in ovarian development, granulosa cell differentiation and luteinization (PubMed:21321049, PubMed:22229724).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...