HTRA3 (NM_053044) Human Untagged Clone
CAT#: SC126498
HTRA3 (untagged)-Human HtrA serine peptidase 3 (HTRA3)
CNY 5488.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Prsp; Tasp |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_053044, the custom clone sequence may differ by one or more nucleotides
ATGCAGGCGCGAGCGCTGCTCCTGGCCGCGTTGGCCGCGCTGGCGCTGGCCCGGGAGCCCCCTGCGGCGC CGTGTCCCGCGCGCTGCGACGTGTCGCGGTGTCCCAGCCCCCGCTGCCCCGGCGGCTACGTGCCCGACCT CTGCAACTGCTGCCTGGTGTGCGCCGCCAGCGAGGGCGAGCCCTGTGGCGGCCCTCTGGACTCGCCTTGC GGCGAGAGCCTGGAGTGCGTGCGCGGCCTATGCCGCTGCCGCTGGTCGCACGCCGTGTGTGGCACCGACG GGCACACCTATGCCAACGTGTGCGCGCTGCAGGCGGCCAGCCGCCGCGCGCTGCAGCTCTCCGGGACGCC CGTGCGCCAGCTGCAGAAGGGCGCCTGCCCGTTGGGTCTCCACCAGCTGAGCAGCCCGCGCTACAAGTTC AACTTCATTGCTGACGTGGTGGAGAAGATCGCACCAGCCGTGGTCCACATAGAGCTCTTCCTGAGACACC CGCTGTTTGGCCGCAACGTGCCCCTGTCCAGCGGTTCTGGCTTCATCATGTCAGAGGCCGGCCTGATCAT CACCAATGCCCACGTGGTGTCCAGCAACAGTGCTGCCCCGGGCAGGCAGCAGCTCAAGGTGCAGCTACAG AATGGGGACTCCTATGAGGCCACCATCAAAGACATCGACAAGAAGTCGGACATTGCCACCATCAAGATCC ATCCCAAGAAAAAGCTCCCTGTGTTGTTGCTGGGTCACTCGGCCGACCTGCGGCCTGGGGAGTTTGTGGT GGCCATCGGCAGTCCCTTCGCCCTACAGAACACAGTGACAACGGGCATCGTCAGCACTGCCCAGCGGGAG GGCAGGGAGCTGGGCCTCCGGGACTCCGACATGGACTACATCCAGACGGATGCCATCATCAACTACGGGA ACTCCGGGGGACCACTGGTGAACCTGGATGGCGAGGTCATTGGCATCAACACGCTCAAGGTCACGGCTGG CATCTCCTTTGCCATCCCCTCAGACCGCATCACACGGTTCCTCACAGAGTTCCAAGACAAGCAGATCAAA GACTGGAAGAAGCGCTTCATCGGCATACGGATGCGGACGATCACACCAAGCCTGGTGGATGAGCTGAAGG CCAGCAACCCGGACTTCCCAGAGGTCAGCAGTGGAATTTATGTGCAAGAGGTTGCGCCGAATTCACCTTC TCAGAGAGGCGGCATCCAAGATGGTGACATCATCGTCAAGGTCAACGGGCGTCCTCTAGTGGACTCGAGT GAGCTGCAGGAGGCCGTGCTGACCGAGTCTCCTCTCCTACTGGAGGTGCGGCGGGGGAACGACGACCTCC TCTTCAGCATCGCACCTGAGGTGGTCATGTGA |
Restriction Sites | Please inquire |
ACCN | NM_053044 |
Insert Size | 2700 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_053044.2, NP_444272.1 |
RefSeq Size | 2585 bp |
RefSeq ORF | 1362 bp |
Locus ID | 94031 |
UniProt ID | P83110 |
Domains | IB, Tryp_SPc, PDZ, kazal |
Protein Families | Druggable Genome, Protease, Secreted Protein |
Gene Summary | Serine protease that cleaves beta-casein/CSN2 as well as several extracellular matrix (ECM) proteoglycans such as decorin/DCN, biglycan/BGN and fibronectin/FN1. Inhibits signaling mediated by TGF-beta family proteins possibly indirectly by degradation of these ECM proteoglycans (By similarity). May act as a tumor suppressor. Negatively regulates, in vitro, trophoblast invasion during placental development and may be involved in the development of the placenta in vivo. May also have a role in ovarian development, granulosa cell differentiation and luteinization (PubMed:21321049, PubMed:22229724).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC207810 | HTRA3 (Myc-DDK-tagged)-Human HtrA serine peptidase 3 (HTRA3) |
CNY 5488.00 |
|
RC207810L1 | Lenti ORF clone of Human HtrA serine peptidase 3 (HTRA3), Myc-DDK-tagged |
CNY 7888.00 |
|
RC207810L2 | Lenti ORF clone of Human HtrA serine peptidase 3 (HTRA3), mGFP tagged |
CNY 5890.00 |
|
RC207810L3 | Lenti ORF clone of Human HtrA serine peptidase 3 (HTRA3), Myc-DDK-tagged |
CNY 5890.00 |
|
RC207810L4 | Lenti ORF clone of Human HtrA serine peptidase 3 (HTRA3), mGFP tagged |
CNY 5890.00 |
|
RG207810 | HTRA3 (tGFP-tagged) - Human HtrA serine peptidase 3 (HTRA3) |
CNY 7088.00 |