P2X2 (P2RX2) (NM_174873) Human Untagged Clone

CAT#: SC125602

P2RX2 (untagged)-Human purinergic receptor P2X, ligand-gated ion channel, 2 (P2RX2), transcript variant 2



  "NM_174873" in other vectors (4)

CNY 6560.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-P2RX2 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DFNA41; P2X2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_174873, the custom clone sequence may differ by one or more nucleotides


ATGGCCGCCGCCCAGCCCAAGTACCCCGCCGGGGCGACCGCCCGGCGCCTGGCCCGGGGCTGCTGGTCCG
CCCTCTGGGACTACGAGACGCCCAAGGTGATCGTGGTGAGGAACCGGCGCCTGGGGGTCCTGTACCGCGC
CGTGCAGCTGCTCATCCTGCTCTACTTCGTGTGGTACGTATTCATCGTGCAGAAAAGCTACCAGGAGAGC
GAGACGGGCCCCGAGAGCTCCATCATCACCAAGGTCAAGGGGATCACCACGTCCGAGCACAAAGTGTGGG
ACGTGGAGGAGTACGTGAAGCCCCCCGAGGGGGGCAGCGTGTTCAGCATCATCACCAGGGTCGAGGCCAC
CCACTCCCAGACCCAGGGAACCTGCCCCGAGAGCATAAGGGTCCACAACGCCACCTGCCTCTCCGACGCC
GACTGCGTGGCTGGGGAGCTGGACATGCTGGGAAACGGCCTGAGGACTGGGCGCTGTGTGCCCTATTACC
AGGGGCCCTCCAAGACCTGCGAGGTGTTCGGCTGGTGCCCGGTGGAAGATGGGGCCTCTGTCAGCCAATT
TCTGGGTACGATGGCCCCAAATTTCACCATCCTCATCAAGAACAGCATCCACTACCCCAAATTCCACTTC
TCCAAGGGCAACATCGCCGACCGCACAGACGGGTACCTGAAGCGCTGCACGTTCCACGAGGCCTCCGACC
TCTACTGCCCCATCTTCAAGCTGGGCTTTATCGTGGAGAAGGCTGGGGAGAGCTTCACAGAGCTCGCACA
CAAGGGTGGTGTCATCGGGGTCATTATCAACTGGGACTGTGACCTGGACCTGCCTGCATCGGAGTGCAAC
CCCAAGTACTCCTTCCGGAGGCTTGACCCCAAGCACGTGCCTGCCTCGTCAGGCTACAACTTCAGGTTTG
CCAAATACTACAAGATCAATGGCACCACCACCCGCACGCTCATCAAGGCCTACGGGATCCGCATTGACGT
CATTGTGCATGGACAGGCCGGGAAGTTCAGCCTGATTCCCACCATTATTAATCTGGCCACAGCTCTGACT
TCCGTCGGGGTGGGCTCCTTCCTGTGCGACTGGATCTTGCTAACATTCATGAACAAAAACAAGGTCTACA
GCCATAAGAAATTTGACAAGATGGTGGACACTCCTGCCTCCGAGCCTGCCCAAGCCTCCACACCCACAGA
CCCCAAAGGTTTGGCTCAACTCTGA


Restriction Sites Please inquire     
ACCN NM_174873
Insert Size 1550 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_174873.1, NP_777362.1
RefSeq Size 1629 bp
RefSeq ORF 1215 bp
Locus ID 22953
UniProt ID Q9UBL9
Protein Families Druggable Genome, Ion Channels: ATP Receptors, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction
Gene Summary The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Binding to ATP mediates synaptic transmission between neurons and from neurons to smooth muscle. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (2) lacks two alternate in-frame segments in the 3' end compared to variant 4. The resulting isoform (B) has the same N- and C-termini but is shorter compared to isoform D.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...