MRPL21 (NM_181515) Human Untagged Clone
CAT＃: SC124776
MRPL21 (untagged)-Human mitochondrial ribosomal protein L21 (MRPL21), nuclear gene encoding mitochondrial protein, transcript variant 1
CNY 1200.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | L21mt; MRP-L21 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_181515, the custom clone sequence may differ by one or more nucleotides
ATGATCGTCACGGGGCAGTATGGCAGGCTCTTTGCCGTGGTGCACTTTGCCAGCCGCCAGTGGAAGGTGA CCTCTGAAGACCTGATCTTAATTGGAAATGAACTAGACCTTGCGTGTGGAGAGAGAATTCGACTGGAGAA GGTCCTGCTGGTTGGGGCAGACAACTTCACGCTGCTTGGCAAGCCACTCCTCGGAAAGGATCTTGTTCGA GTAGAAGCCACAGTCATTGAAAAGACAGAATCATGGCCAAGAATCATTATGAGATTCAGGAAAAGGAAAA ACTTCAAGAAGAAAAGAATCGTCACGACCCCGCAGACTGTCCTCCGGATAAACAGCATTGAGATTGCTCC GTGTTTGTTGTGA >OriGene 5' read for NM_181515 unedited
GCACGAGCCTCGTGCCGAATTCGGCACGAGGGCAGCATCTTCCCTGACGGTCACCTTAGG GCGGCTGGCGTCCGCGTGCAGCCACAGCATCCTGAGACCTTCGGGGCCCGGAGCAGCCTC CCTTTGGTCTGCTTCTCGAAGGTTCAATTCACAGAGCACTTCATATCTACCAGGATATGT TCCTAAAACATCCCTGAGTTCACCACCTTGGCCAGAAGTTGTTCTGCCAGACCCAGTTGA GGAGACCAGACACCATGCAGAGGTCGTGAAGAAGGTGAATGAGATGATCGTCACGGGGCA GTATGGCAGGCTCTTTGCCGTGGTGCACTTTGCCAGCCGCCAGTGGAAGGTGACCTCTGA AGACCTGATCTTAATTGGAAATGAACTAGACCTTGCGTGTGGAGAGAGAATTCGACTGGA GAAGGTCCTGCTGGTTGGGGCAGACAACTTCACGCTGCTTGGCAAGCCACTCCTCGGAAA GGATCTTGTTCGAGTAGAAGCCACAGTCATTGAAAAGACAGAATCATGGCCAAGAATCAT TATGAGATTCAGGAAAAGGAAAAACTTCAAGAAAAAAGAATCGTCACGACCCCGCAGACT GTCCTCCGGATAAACAGATTGAA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_181515 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_181515.1, NP_852616.1 |
| RefSeq Size | 726 bp |
| RefSeq ORF | 363 bp |
| Locus ID | 219927 |
| UniProt ID | Q7Z2W9 |
| Gene Summary | Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Multiple transcript variants encoding different isoforms were identified through sequence analysis although some may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) uses a different splice site in the 5' end, compared to variant 4, that likely leads to the use of a downstream start codon. The predicted protein (isoform a) is shorter than isoform d. The predicted ORF of this transcript has not been experimentally confirmed. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC208883 | MRPL21 (Myc-DDK-tagged)-Human mitochondrial ribosomal protein L21 (MRPL21), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 3990.00 |
|
| RC208883L3 | Lenti-ORF clone of MRPL21 (Myc-DDK-tagged)-Human mitochondrial ribosomal protein L21 (MRPL21), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 5890.00 |
|
| RC208883L4 | Lenti-ORF clone of MRPL21 (mGFP-tagged)-Human mitochondrial ribosomal protein L21 (MRPL21), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 5890.00 |
|
| RG208883 | MRPL21 (tGFP-tagged) - Human mitochondrial ribosomal protein L21 (MRPL21), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 4370.00 |
|
| SC321128 | MRPL21 (untagged)-Human mitochondrial ribosomal protein L21 (MRPL21), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 1200.00 |
