NSE2 (NSMCE2) (NM_173685) Human Untagged Clone
CAT#: SC123332
NSMCE2 (untagged)-Human non-SMC element 2, MMS21 homolog (S. cerevisiae) (NSMCE2)
CNY 3990.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C8orf36; MMS21; NSE2; ZMIZ7 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_173685 edited
CCACGCGTCCGGCCCGCTCTCACTTTTCAGCGGCAGGCGAAGGGGGCTGAGGAAAGGAGG TGGGTCTAGGCAGGGGAAATTGGGGTGCCACCAGACGGAGACAGCTTGGACTACCAGAAT CAAGCACTCTTTTGGAAGAGGGTAATCTCTCTCCAAAAACTGAGGACACTTACCTTCCCC ATATATTGAGTCCAGCTGTGTTTGGTGGCCCAGGTACTAATTTCAAGATGCCAGGACGTT CCAGTTCAAATTCAGGTTCAACTGGTTTCATCTCCTTCAGTGGTGTAGAGTCTGCTCTCT CCTCCTTGAAAAACTTCCAAGCCTGTATCAACTCTGGTATGGACACAGCTTCTAGTGTTG CTTTGGATCTTGTGGAAAGTCAGACTGAAGTGAGTAGTGAATATAGTATGGACAAGGCAA TGGTTGAATTTGCTACATTGGATCGGCAACTAAACCATTATGTAAAGGCTGTTCAATCTA CAATAAATCATGTGAAAGAAGAACGTCCAGAAAAAATACCAGATTTAAAATTATTGGTAG AGAAGAAATTTTTGGCTTTACAGAGCAAGAATTCTGATGCAGACTTTCAAAATAATGAAA AATTTGTACAGTTTAAACAACAGCTGAAAGAACTAAAGAAGCAATGTGGTCTTCAAGCTG ACAGAGAAGCTGACGGAACAGAAGGAGTGGATGAAGATATAATTGTGACCCAAAGTCAGA CCAACTTCACCTGCCCCATTACAAAGGAGGAAATGAAGAAGCCAGTGAAAAATAAAGTGT GTGGCCACACCTATGAAGAGGACGCCATTGTTCGCATGATTGAGTCCAGGCAAAAGCGGA AGAAAAAGGCCTATTGCCCTCAAATTGGCTGTAGCCACACGGATATAAGAAAGTCAGATC TTATCCAGGATGAAGCACTTAGAAGGGCAATTGAGAACCATAACAAGAAAAGACATCGTC ATTCCGAGTAGGAAAAGCCACCTGCCTGCAGGGACACCAGCAGCCTACCTCCTACCCCAG CTGTCTGTTGAGAGCAGTGCTGACCCCAGCAGTTAGGGACTGGCTGCATAGCATACTTGT TGGGGGTAAAACTTGTTGCTTTTATGTGTGCTTGAAAACATTTTTCAAAGTTACACAACA GAAATGCAATCATATTGTTTATTTTTAAGTGTTCTATAATGTTAAATAAAACTTTGATCA TCTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_173685 |
| Insert Size | 1258 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_173685.1, NP_775956.1 |
| RefSeq Size | 1258 bp |
| RefSeq ORF | 744 bp |
| Locus ID | 286053 |
| UniProt ID | Q96MF7 |
| Gene Summary | This gene encodes a member of a family of E3 small ubiquitin-related modifier (SUMO) ligases that mediates the attachment of a SUMO protein to proteins involved in nuclear transport, transcription, chromosome segregation and DNA repair. The encoded protein is part of the structural maintenance of chromosomes (SMC) 5/6 complex which plays a key role genome maintenance, facilitating chromosome segregation and suppressing mitotic recombination. A knockout of the orthologous mouse gene is lethal prior to embryonic day 10.5. Naturally occurring mutations in this gene, that abolish the SUMO ligase activity, are associated with primordial dwarfism and extreme insulin resistance. [provided by RefSeq, Mar 2017] Transcript Variant: This variant (1) encodes the longer isoform (1). Variants 1-3 encode the same isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC207639 | NSMCE2 (Myc-DDK-tagged)-Human non-SMC element 2, MMS21 homolog (S. cerevisiae) (NSMCE2) |
CNY 3600.00 |
|
| RC207639L1 | Lenti ORF clone of Human non-SMC element 2, MMS21 homolog (S. cerevisiae) (NSMCE2), Myc-DDK-tagged |
CNY 6000.00 |
|
| RC207639L2 | Lenti ORF clone of Human non-SMC element 2, MMS21 homolog (S. cerevisiae) (NSMCE2), mGFP tagged |
CNY 5890.00 |
|
| RC207639L3 | Lenti ORF clone of Human non-SMC element 2, MMS21 homolog (S. cerevisiae) (NSMCE2), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC207639L4 | Lenti ORF clone of Human non-SMC element 2, MMS21 homolog (S. cerevisiae) (NSMCE2), mGFP tagged |
CNY 6000.00 |
|
| RG207639 | NSMCE2 (tGFP-tagged) - Human non-SMC element 2, MMS21 homolog (S. cerevisiae) (NSMCE2) |
CNY 5200.00 |
