REG1 beta (REG1B) (NM_006507) Human Untagged Clone

CAT#: SC122746

REG1B (untagged)-Human regenerating islet-derived 1 beta (REG1B)



  "NM_006507" in other vectors (4)

CNY 2400.00

CNY 2950.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


REG1B rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PSPS2; REGH; REGI-BETA; REGL
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_006507 edited
CAGAGATTGCTGATTTGCTCCTTAAGCAAGAGATTCACTGCCGCTAAGCATGGCTCAGAC
CAACTCGTTCTTCATGCTGATCTCCTCCCTGATGTTCCTGTCTCTGAGCCAAGGCCAGGA
GTCCCAGACAGAGCTGCCTAATCCCCGAATCAGCTGCCCAGAAGGCACCAATGCCTATCG
CTCCTACTGCTACTACTTTAATGAAGACCCTGAGACCTGGGTTGATGCAGATCTCTATTG
CCAGAACATGAATTCAGGCAACCTGGTGTCTGTGCTCACCCAGGCGGAGGGTGCCTTCGT
GGCCTCACTGATTAAGGAGAGTAGCACTGATGACAGCAATGTCTGGATTGGCCTCCATGA
CCCAAAAAAGAACCGCCGCTGGCACTGGAGTAGTGGGTCCCTGGTCTCCTACAAGTCCTG
GGACACTGGATCCCCGAGCAGTGCTAATGCTGGCTACTGTGCAAGCCTGACTTCATGCTC
AGGATTCAAGAAATGGAAGGATGAATCTTGTGAGAAGAAGTTCTCCTTTGTTTGCAAGTT
CAAAAACTAGAGGAAGCTGAAAAATGGATGTCTAGAACTGGTCCTGCAATTACTATGAAG
TCAAAAATTAAACTAGACTATGTCTCCAACTCAGTTCAGACCATCTCCTCCCTAATGAGT
TTGCATCGCTGATCTTCAGTACCTTCACCTGTCTCAGTCTCTAGAGCCCTGAAAAATAAA
AACAAACTTATTTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_006507
Insert Size 793 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_006507.2, NP_006498.1
RefSeq Size 773 bp
RefSeq ORF 501 bp
Locus ID 5968
UniProt ID P48304
Gene Summary This gene is a type I subclass member of the Reg gene family. The Reg gene family is a multigene family grouped into four subclasses, types I, II, III and IV based on the primary structures of the encoded proteins. This gene encodes a protein secreted by the exocrine pancreas that is highly similar to the REG1A protein. The related REG1A protein is associated with islet cell regeneration and diabetogenesis, and may be involved in pancreatic lithogenesis. Reg family members REG1A, REGL, PAP and this gene are tandemly clustered on chromosome 2p12 and may have arisen from the same ancestral gene by gene duplication. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...