PPP1R14C (NM_030949) Human Untagged Clone
CAT#: SC120521
PPP1R14C (untagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 14C (PPP1R14C)
CNY 1200.00
CNY 3990.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CPI17-like; KEPI; NY-BR-81 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC120521 representing NM_030949.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGGTGGCGACGGGCAGCAGCGAGACGGCCGGCGGGGCCAGCGGCGGCGGCGCACGGGTTTTCTTC CAAAGCCCCCGGGGTGGCGCCGGTGGCAGCCCCGGCTCCAGCAGCGGCTCAGGCTCCTCCCGGGAGGAC TCGGCGCCCGTGGCCACGGCGGCCGCTGCAGGGCAGGTTCAGCAGCAACAGCAGCGGCGACACCAGCAG GGAAAAGTGACAGTGAAATACGATCGTAAGGAGCTTCGGAAGCGGCTGGTGCTGGAGGAATGGATCGTG GAGCAGCTGGGTCAGCTCTACGGCTGCGAGGAAGAAGAAATGCCAGAGGTAGAAATTGACATTGATGAT CTTCTTGATGCAGACAGTGATGAAGAGAGAGCTTCAAAATTACAGGAAGCTCTTGTAGACTGCTACAAA CCAACAGAGGAATTTATCAAAGAGCTGCTTTCTCGGATAAGAGGCATGAGGAAACTGAGCCCTCCGCAG AAGAAGAGTGTATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_030949 |
| Insert Size | 498 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_030949.1 |
| RefSeq Size | 2211 bp |
| RefSeq ORF | 498 bp |
| Locus ID | 81706 |
| UniProt ID | Q8TAE6 |
| Domains | PP1_inhibitor |
| Protein Families | Druggable Genome |
| MW | 17.8 kDa |
| Gene Summary | The degree of protein phosphorylation is regulated by a balance of protein kinase and phosphatase activities. Protein phosphatase-1 (PP1; see MIM 176875) is a signal-transducing phosphatase that influences neuronal activity, protein synthesis, metabolism, muscle contraction, and cell division. PPP1R14C is an inhibitor of PP1 (Liu et al., 2002 [PubMed 11812771]).[supplied by OMIM, Feb 2010] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Identification of Two Forms of TNF Tolerance in Human Monocytes: Differential Inhibition of NF-?B/AP-1- and PP1-Associated Signaling
,Günther, J;Vogt, N;Hampel, K;Bikker, R;Page, S;Müller, B;Kandemir, J;Kracht, M;Dittrich-Breiholz, O;Huber, R;Brand, K;,
J. Immunol.
,PubMed ID 24574500
[PPP1R14C]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204943 | PPP1R14C (Myc-DDK-tagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 14C (PPP1R14C) |
CNY 3990.00 |
|
| RC204943L3 | Lenti-ORF clone of PPP1R14C (Myc-DDK-tagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 14C (PPP1R14C) |
CNY 5890.00 |
|
| RC204943L4 | Lenti-ORF clone of PPP1R14C (mGFP-tagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 14C (PPP1R14C) |
CNY 5890.00 |
|
| RG204943 | PPP1R14C (tGFP-tagged) - Human protein phosphatase 1, regulatory (inhibitor) subunit 14C (PPP1R14C) |
CNY 2800.00 |
其它PPP1R14C产品

