BIRC5 (NM_001168) Human Untagged Clone
CAT#: SC119405
BIRC5 (untagged)-Human baculoviral IAP repeat containing 5 (BIRC5/Survivin), transcript variant 1
CNY 1200.00
CNY 5130.00
| Cited in 6 publications. |
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | API4; EPR-1 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001168 edited
ATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCT ACATTCAAGAACTGGCCCTTCTTGGAGGGCTGCGCCTGCACCCCGGAGCGGATGGCCGAG GCTGGCTTCATCCACTGCCCCACTGAGAACGAGCCAGACTTGGCCCAGTGTTTCTTCTGC TTCAAGGAGCTGGAAGGCTGGGAGCCAGATGACGACCCCATAGAGGAACATAAAAAGCAT TCGTCCGGTTGCGCTTTCCTTTCTGTCAAGAAGCAGTTTGAAGAATTAACCCTTGGTGAA TTTTTGAAACTGGACAGAGAAAGAGCCAAGAACAAAATTGCAAAGGAAACCAACAATAAG AAGAAAGAATTTGAGGAAACTGCGGAGAAAGTGCGCCGTGCCATCGAGCAGCTGGCTGCC ATGGATTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001168 |
| Insert Size | 429 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001168.2, NP_001159.2 |
| RefSeq Size | 2655 bp |
| RefSeq ORF | 429 bp |
| Locus ID | 332 |
| UniProt ID | O15392 |
| Domains | BIR |
| Protein Families | Druggable Genome, Stem cell - Pluripotency |
| Protein Pathways | Colorectal cancer, Pathways in cancer |
| Gene Summary | This gene is a member of the inhibitor of apoptosis (IAP) gene family, which encode negative regulatory proteins that prevent apoptotic cell death. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but this gene encodes proteins with only a single BIR domain. The encoded proteins also lack a C-terminus RING finger domain. Gene expression is high during fetal development and in most tumors, yet low in adult tissues. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2011] Transcript Variant: This variant (1) represents the most frequently occurring transcript and it encodes isoform 1. |
Citations (6)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
BIRC5/Survivin is a novel ATG12-ATG5 conjugate interactor and an autophagy-induced DNA damage suppressor in human cancer and mouse embryonic fibroblast cells
,Lin, TY;Chan, HH;Chen, SH;Sarvagalla, S;Chen, PS;Coumar, MS;Cheng, SM;Chang, YC;Lin, CH;Leung, E;Cheung, CHA;,
Autophagy
,PubMed ID 31612776
[BIRC5]
|
|
Overexpression of miR-214-3p in esophageal squamous cancer cells enhances sensitivity to cisplatin by targeting survivin directly and indirectly through CUG-BP1
,Phatak, P;Byrnes, KA;Mansour, D;Liu, L;Cao, S;Li, R;Rao, JN;Turner, DJ;Wang, JY;Donahue, JM;,
Oncogene
,PubMed ID 26234674
[BIRC5]
|
|
Synergistic Induction of Erlotinib-Mediated Apoptosis by Resveratrol in Human Non-Small-Cell Lung Cancer Cells by Down-Regulating Survivin and Up-Regulating PUMA
,Nie, P;Hu, W;Zhang, T;Yang, Y;Hou, B;Zou, Z;,
Cell. Physiol. Biochem.
,PubMed ID 25895606
[BIRC5]
|
|
cIAP1 stability contributes to YM155 resistance in human gastric cancer cells
,Jung, SA;Park, YM;Hong, SW;Moon, JH;Shin, JS;Lee, HR;Ha, SH;Lee, DH;Kim, JH;Kim, SM;Kim, JE;Kim, KP;Hong, YS;Choi, EK;Lee, JS;Jin, DH;Kim, T;,
J. Biol. Chem.
,PubMed ID 25635055
[BIRC5]
|
|
Survivin transcript variant 2 drives angiogenesis and malignant progression in proneural gliomas
,Doucette, T;Latha, K;Yang, Y;Fuller, GN;Rao, A;Rao, G;,
Neuro-oncology
,PubMed ID 24676140
[BIRC5]
|
|
Sorafenib Overcomes TRAIL Resistance of Hepatocellular Carcinoma Cells through the Inhibition of STAT3
,Kuen-Feng Chen, Wei-Tien Tai, Tsung-Hao Liu, Hsiang-Po Huang, Yu-Chin Lin, Chung-Wai Shiau, Pui-Kai Li, Pei-Jer Chen, and Ann-Lii Cheng,
Clin. Cancer Res., Nov 2010; 16: 5189 - 5199
[BIRC5]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC205935 | BIRC5 (Myc-DDK-tagged)-Human baculoviral IAP repeat containing 5 (BIRC5/Survivin), transcript variant 1 |
CNY 1800.00 |
|
| RC205935L1 | Lenti ORF clone of Human baculoviral IAP repeat containing 5 (BIRC5), transcript variant 1, Myc-DDK-tagged |
CNY 4200.00 |
|
| RC205935L2 | Lenti ORF clone of Human baculoviral IAP repeat containing 5 (BIRC5), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC205935L3 | Lenti ORF clone of Human baculoviral IAP repeat containing 5 (BIRC5), transcript variant 1, Myc-DDK-tagged |
CNY 4200.00 |
|
| RC205935L4 | Lenti ORF clone of Human baculoviral IAP repeat containing 5 (BIRC5), transcript variant 1, mGFP tagged |
CNY 4200.00 |
|
| RG205935 | BIRC5 (tGFP-tagged) - Human baculoviral IAP repeat containing 5 (BIRC5/Survivin), transcript variant 1 |
CNY 3400.00 |
