NIPSNAP2 (NM_001483) Human Untagged Clone
CAT#: SC119243
GBAS (untagged)-Human glioblastoma amplified sequence (GBAS), nuclear gene encoding mitochondrial protein, transcript variant 1
CNY 3600.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | GBAS |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC119243 representing NM_001483.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGCGCGAGTGCTGCGCGCCCGCGGAGCGGCCTGGGCCGGCGGCCTCCTGCAGCGGGCGGCCCCC TGCAGCCTCCTGCCCAGGCTCCGGACATGGACATCTTCCAGCAACAGATCTCGAGAAGACAGCTGGCTA AAATCCTTATTTGTCCGGAAAGTTGATCCAAGAAAAGATGCCCACTCCAATCTCCTAGCCAAAAAGGAA ACAAGCAATCTATACAAATTACAGTTTCACAATGTTAAACCGGAATGCCTAGAAGCATACAACAAAATT TGTCAAGAGGTGTTGCCAAAGATTCACGAAGATAAACACTACCCTTGTACTTTGGTGGGGACTTGGAAC ACGTGGTATGGCGAGCAGGACCAAGCTGTCCACCTCTGGAGGTATGAAGGAGGCTATCCAGCCCTCACA GAAGTCATGAATAAACTCAGAGAAAATAAGGAATTTTTGGAATTTCGTAAGGCAAGAAGTGACATGCTT CTCTCCAGGAAGAATCAGCTCCTGTTGGAGTTCAGTTTCTGGAATGAGCCTGTGCCAAGATCCGGACCT AATATATATGAACTCAGGTCTTACCAACTCCGACCAGGAACCATGATTGAATGGGGCAATTACTGGGCT CGTGCAATCCGCTTCAGACAGGATGGTAACGAAGCCGTCGGAGGATTCTTCTCTCAGATTGGGCAGCTG TACATGGTGCACCATCTTTGGGCTTACAGGGATCTTCAGACCAGGGAAGACATACGGAATGCAGCATGG CACAAACATGGCTGGGAGGAATTGGTATATTACACAGTTCCACTTATTCAGGAAATGGAATCCAGAATC ATGATCCCACTGAAGACCTCGCCCCTCCAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001483 |
| Insert Size | 861 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001483.2 |
| RefSeq Size | 2019 bp |
| RefSeq ORF | 861 bp |
| Locus ID | 2631 |
| UniProt ID | O75323 |
| MW | 33.7 kDa |
| Gene Summary | This gene encodes a member of the NipSnap family of proteins that may be involved in vesicular transport. The encoded protein is localized to mitochondria and plays a role in oxidative phosphorylation. A pseudogene of this gene is located on the long arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC205027 | GBAS (Myc-DDK-tagged)-Human glioblastoma amplified sequence (GBAS), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 3600.00 |
|
| RC205027L1 | Lenti ORF clone of Human glioblastoma amplified sequence (GBAS), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 6000.00 |
|
| RC205027L2 | Lenti ORF clone of Human glioblastoma amplified sequence (GBAS), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC205027L3 | Lenti ORF clone of Human glioblastoma amplified sequence (GBAS), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC205027L4 | Lenti ORF clone of Human glioblastoma amplified sequence (GBAS), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG205027 | GBAS (tGFP-tagged) - Human glioblastoma amplified sequence (GBAS), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 5200.00 |
其它NIPSNAP2产品

