GJA4 (NM_002060) Human Untagged Clone

CAT#: SC118876

GJA4 (untagged)-Human gap junction protein, alpha 4, 37kDa (GJA4)



  "NM_002060" in other vectors (7)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
Rabbit Polyclonal Anti-GJA4 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CX37
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC118876 representing NM_002060.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGTGACTGGGGCTTCCTGGAGAAGTTGCTGGACCAGGTCCAGGAGCACTCGACCGTGGTGGGTAAG
ATCTGGCTGACGGTGCTCTTCATCTTCCGCATCCTCATCCTGGGCCTGGCCGGCGAGTCAGTGTGGGGT
GACGAGCAATCAGATTTCGAGTGTAACACGGCCCAGCCAGGCTGCACCAACGTCTGCTATGACCAGGCC
TTCCCCATCTCCCACATCCGCTACTGGGTGCTGCAGTTCCTCTTCGTCAGCACACCCACCCTGGTCTAC
CTGGGCCATGTCATTTACCTGTCTCGGCGAGAAGAGCGGCTGCGGCAGAAGGAGGGGGAGCTGCGGGCA
CTGCCGGCCAAGGACCCACAGGTGGAGCGGGCGCTGGCGGCCGTAGAGCGTCAGATGGCCAAGATCTCG
GTGGCAGAAGATGGTCGCCTGCGCATCCGCGGAGCACTGATGGGCACCTATGTCGCCAGTGTGCTCTGC
AAGAGTGTGCTAGAGGCAGGCTTCCTCTATGGCCAGTGGCGCCTGTACGGCTGGACCATGGAGCCCGTG
TTTGTGTGCCAGCGAGCACCCTGCCCCTACCTCGTGGACTGCTTTGTCTCTCGCCCCACGGAGAAGACC
ATCTTCATCATCTTCATGTTGGTGGTTGGACTCATCTCCCTGGTGCTTAACCTGCTGGAGTTGGTGCAC
CTGCTGTGTCGCTGCCTCAGCCGGGGGATGAGGGCACGGCAAGGCCAAGACGCACCCCCGACCCAGGGC
ACCTCCTCAGACCCTTACACGGACCAGGTCTTCTTCTACCTCCCCGTGGGCCAGGGGCCCTCATCCCCA
CCATGCCCCACCTACAATGGGCTCTCATCCAGTGAGCAGAACTGGGCCAACCTGACCACAGAGGAGAGG
CTGGCGTCTTCCAGGCCCCCTCTCTTCCTGGACCCACCCCCTCAGAATGGCCAAAAACCCCCAAGTCGT
CCCAGCAGCTCTGCTTCTAAGAAGCAGTATGTATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_002060
Insert Size 1002 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002060.2
RefSeq Size 1710 bp
RefSeq ORF 1002 bp
Locus ID 2701
UniProt ID P35212
Domains CNX
Protein Families Ion Channels: Other, Transmembrane
MW 37.4 kDa
Gene Summary This gene encodes a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Mutations in this gene have been associated with atherosclerosis and a higher risk of myocardial infarction. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...