GABPB2 (GABPB1) (NM_002041) Human Untagged Clone
CAT#: SC118866
GABPB1 (untagged)-Human GA binding protein transcription factor, beta subunit 1 (GABPB1), transcript variant gamma-1
CNY 3656.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BABPB2; E4TF1; E4TF1-47; E4TF1-53; E4TF1B; GABPB; GABPB-1; GABPB2; NRF2B1; NRF2B2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_002041, the custom clone sequence may differ by one or more nucleotides
ATGTCCCTGGTAGATTTGGGAAAGAAGCTTTTAGAAGCGGCACGAGCAGGTCAAGATGATGAAGTTCGTA TTTTGATGGCAAATGGAGCTCCCTTTACTACAGACTGGCTGGGAACTTCTCCACTTCATCTAGCAGCACA GTATGGTCATTATTCCACCACAGAGGTACTGCTGCGAGCTGGTGTGAGCAGAGATGCCAGAACCAAAGTG GACCGAACACCATTACATATGGCAGCTTCTGAGGGCCATGCCAGCATAGTAGAGGTTTTACTTAAGCATG GTGCTGATGTCAATGCAAAGGACATGTTAAAGATGACAGCTCTCCATTGGGCCACAGAACACAATCATCA AGAGGTGGTGGAACTTTTAATCAAATATGGTGCTGATGTACACACGCAAAGTAAATTTTGTAAAACTGCA TTTGATATTTCAATAGACAATGGAAATGAAGATTTAGCAGAGATATTACAGATTGCTATGCAGAACCAAA TCAACACAAACCCAGAGAGTCCTGACACTGTGACAATACATGCTGCAACACCACAGTTTATCATTGGACC TGGAGGGGTGGTGAACCTAACAGGTCTGGTATCTTCAGAAAATTCATCCAAGGCAACAGATGAAACGGGT GTATCTGCTGTTCAGTTTGGAAACTCTTCTACATCAGTATTAGCTACATTAGCTGCCTTAGCTGAAGCAT CTGCTCCATTGTCCAATTCTTCAGAAACTCCAGTAGTGGCCACAGAAGAAGTAGTTACTGCAGAATCTGT GGATGGTGCCATTCAGCAAGTAGTTAGTTCAGGGGGTCAGCAAGTCATCACAATAGTTACAGATGGAATT CAGCTTGGAAATTTGCACTCTATTCCAACCAGTGGAATTGGTCAGCCCATCATTGTGACCATGCCAGATG GACAACAAGTATTAACAGTACCAGCAACAGACATTGCTGAAGAAACTGTTATAAGTGAAGAACCACCAGC TAAGAGACAATGTATCGAAATAATTGAAAACCGGGTGGAATCTGCAGAAATAGAAGTAAGGAGTCTTTTA CCCGGTGTGCTTTGCCGCAGTCATCCAAAATAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | NotI-NotI |
ACCN | NM_002041 |
Insert Size | 2740 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_002041.1, NP_002032.1 |
RefSeq Size | 1658 bp |
RefSeq ORF | 1152 bp |
Locus ID | 2553 |
UniProt ID | Q06547 |
Protein Families | Transcription Factors |
Gene Summary | This gene encodes the GA-binding protein transcription factor, beta subunit. This protein forms a tetrameric complex with the alpha subunit, and stimulates transcription of target genes. The encoded protein may be involved in activation of cytochrome oxidase expression and nuclear control of mitochondrial function. The crystal structure of a similar protein in mouse has been resolved as a ternary protein complex. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (gamma 1) uses an alternate in-frame splice site in the 3' coding region, compared to variant beta 1, resulting in a shorter isoform (gamma 1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204396 | GABPB1 (Myc-DDK-tagged)-Human GA binding protein transcription factor, beta subunit 1 (GABPB1), transcript variant gamma-1 |
CNY 3656.00 |
|
RC204396L3 | Lenti ORF clone of Human GA binding protein transcription factor, beta subunit 1 (GABPB1), transcript variant gamma-1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC204396L4 | Lenti ORF clone of Human GA binding protein transcription factor, beta subunit 1 (GABPB1), transcript variant gamma-1, mGFP tagged |
CNY 5890.00 |
|
RG204396 | GABPB1 (tGFP-tagged) - Human GA binding protein transcription factor, beta subunit 1 (GABPB1), transcript variant gamma-1 |
CNY 5256.00 |
|
SC324667 | GABPB1 (untagged)-Human GA binding protein transcription factor, beta subunit 1 (GABPB1), transcript variant gamma-1 |
CNY 3656.00 |