UCP2 (NM_003355) Human Untagged Clone
CAT#: SC118051
UCP2 (untagged)-Human uncoupling protein 2 (mitochondrial, proton carrier) (UCP2), nuclear gene encoding mitochondrial protein
CNY 3600.00
| Cited in 1 publication. | 
Product images
                    
                Specifications
| Product Data | |
| Type | Human Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | BMIQ4; SLC25A8; UCPH | 
| Vector | pCMV6-AC | 
| E. coli Selection | Ampicillin (100 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | 
                
                
                
                 >OriGene sequence for NM_003355.2
TGTCCACGCTCGCCCGGCTCGTCCGACGCGCCCTCCGCCAGCCGACAGACACAGCCGCAC 
GCACTGCCGTGTTCTCCCTGCGGCTCGGACACATAGTATGACCATTAGGTGTTTCGTCTC CCACCCATTTTCTATGGAAAACCAAGGGGATCGGGCCATGATAGCCACTGGCAGCTTTGA AGAACGGGACACCTTTAGAGAAGCTTGATCTTGGAGGCCTCACCGTGAGACCTTACAAAG CCGGATTCCGGCAGAGTTCCTCTATCTCGTCTTGTTGCTGATTAAAGGTGCCCCTGTCTC CAGTTTTTCTCCATCTCCTGGGACGTAGCAGGAAATCAGCATCATGGTTGGGTTCAAGGC CACAGATGTGCCCCCTACTGCCACTGTGAAGTTTCTTGGGGCTGGCACAGCTGCCTGCAT CGCAGATCTCATCACCTTTCCTCTGGATACTGCTAAAGTCCGGTTACAGATCCAAGGAGA AAGTCAGGGGCCAGTGCGCGCTACAGCCAGCGCCCAGTACCGCGGTGTGATGGGCACCAT TCTGACCATGGTGCGTACTGAGGGCCCCCGAAGCCTCTACAATGGGCTGGTTGCCGGCCT GCAGCGCCAAATGAGCTTTGCCTCTGTCCGCATCGGCCTGTATGATTCTGTCAAACAGTT CTACACCAAGGGCTCTGAGCATGCCAGCATTGGGAGCCGCCTCCTAGCAGGCAGCACCAC AGGTGCCCTGGCTGTGGCTGTGGCCCAGCCCACGGATGTGGTAAAGGTCCGATTCCAAGC TCAGGCCCGGGCTGGAGGTGGTCGGAGATACCAAAGCACCGTCAATGCCTACAAGACCAT TGCCCGAGAGGAAGGGTTCCGGGGCCTCTGGAAAGGGACCTCTCCCAATGTTGCTCGTAA TGCCATTGTCAACTGTGCTGAGCTGGTGACCTATGACCTCATCAAGGATGCCCTCCTGAA AGCCAACCTCATGACAGATGACCTCCCTTGCCACTTCACTTCTGCCTTTGGGGCAGGCTT CTGCACCACTGTCATCGCCTCCCCTGTAGACGTGGTCAAGACGAGATACATGAACTCTGC CCTGGGCCAGTACAGTAGCGCTGGCCACTGTGCCCTTACCATGCTCCAGAAGGAGGGGCC CCGAGCCTTCTACAAAGGGTTCATGCCCTCCTTTCTCCGCTTGGGTTCCTGGAACGTGGT GATGTTCGTCACCTATGAGCAGCTGAAACGAGCCCTCATGGCTGCCTGCACTTCCCGAGA GGCTCCCTTCTGAGCCTCTCCTGCTGCTGACCTGATCACCTCTGGCTTTGTCTCTAGCCG GGCCATGCTTTCCTTTTCTTCCTTCTTTCTCTTCCCTCCTTCCCTTCTCTCCTTCCCTCT TTCCCCACCTCTTCCTTCCGCTCCTTTACCTACCACCTTCCCTCTTTCTACATTCTCATC TACTCATTGTCTCAGTGCTGGTGGAGTTGACATTTGACAGTGTGGGAGGCCTCGTACCAG CCAGGATCCCAAGCGTCCCGTCCCTTGGAAAGTTCAGCCAGAATCTTCGTCCTGCCCCCG ACAGCCCAGCCTAGCCCACTTGTCATCCATAAAGCAAGCTCAACCTTGAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAA  | 
        
| Restriction Sites | NotI-NotI | 
| ACCN | NM_003355 | 
| Insert Size | 1660 bp | 
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info  | 
        
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_003355.2, NP_003346.2 | 
| RefSeq Size | 1646 bp | 
| RefSeq ORF | 930 bp | 
| Locus ID | 7351 | 
| UniProt ID | P55851 | 
| Domains | mito_carr | 
| Protein Families | Druggable Genome | 
| Gene Summary | Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed in many tissues, with the greatest expression in skeletal muscle. It is thought to play a role in nonshivering thermogenesis, obesity and diabetes. Chromosomal order is 5'-UCP3-UCP2-3'. [provided by RefSeq, Jul 2008] | 
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: | 
|---|
| 
                                                Onconase induces autophagy sensitizing pancreatic cancer cells to gemcitabine and activates Akt/mTOR pathway in a ROS-dependent manner
                                                ,Fiorini, C;Cordani, M;Gotte, G;Picone, D;Donadelli, M;,
                                                Biochim. Biophys. Acta
                                                ,PubMed ID 25533084
                                                [UCP2]
                                                 | 
                                        
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| RC203997 | UCP2 (Myc-DDK-tagged)-Human uncoupling protein 2 (mitochondrial, proton carrier) (UCP2), nuclear gene encoding mitochondrial protein | 
                                                     CNY 3600.00  | 
                                            |
| RC203997L1 | Lenti ORF clone of Human uncoupling protein 2 (mitochondrial, proton carrier) (UCP2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged | 
                                                     CNY 6000.00  | 
                                            |
| RC203997L2 | Lenti ORF clone of Human uncoupling protein 2 (mitochondrial, proton carrier) (UCP2), nuclear gene encoding mitochondrial protein, mGFP tagged | 
                                                     CNY 5890.00  | 
                                            |
| RC203997L3 | Lenti ORF clone of Human uncoupling protein 2 (mitochondrial, proton carrier) (UCP2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged | 
                                                     CNY 5890.00  | 
                                            |
| RC203997L4 | Lenti ORF clone of Human uncoupling protein 2 (mitochondrial, proton carrier) (UCP2), nuclear gene encoding mitochondrial protein, mGFP tagged | 
                                                     CNY 6000.00  | 
                                            |
| RG203997 | UCP2 (tGFP-tagged) - Human uncoupling protein 2 (mitochondrial, proton carrier) (UCP2), nuclear gene encoding mitochondrial protein | 
                                                     CNY 5200.00  | 
                                            |
| SC320879 | UCP2 (untagged)-Human uncoupling protein 2 (mitochondrial, proton carrier) (UCP2), nuclear gene encoding mitochondrial protein | 
                                                     CNY 3600.00  | 
                                            
