BMI1 (NM_005180) Human Untagged Clone
CAT#: SC116894
BMI1 (untagged)-Human BMI1 polycomb ring finger oncogene (BMI1)
CNY 3600.00
Cited in 2 publications. |
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | flvi-2/bmi-1; FLVI2/BMI1; PCGF4; RNF51 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_005180 edited
ATGCATCGAACAACGAGAATCAAGATCACTGAGCTAAATCCCCACCTGATGTGTGTGCTT TGTGGAGGGTACTTCATTGATGCCACAACCATAATAGAATGTCTACATTCCTTCTGTAAA ACGTGTATTGTTCGTTACCTGGAGACCAGCAAGTATTGTCCTATTTGTGATGTCCAAGTT CACAAGACCAGACCACTACTGAATATAAGGTCAGATAAAACTCTCCAAGATATTGTATAC AAATTAGTTCCAGGGCTTTTCAAAAATGAAATGAAGAGAAGAAGGGATTTTTATGCAGCT CATCCTTCTGCTGATGCTGCCAATGGCTCTAATGAAGATAGAGGAGAGGTTGCAGATGAA GATAAGAGAATTATAACTGATGATGAGATAATAAGCTTATCCATTGAATTCTTTGACCAG AACAGATTGGATCGGAAAGTAAACAAAGACAAAGAGAAATCTAAGGAGGAGGTGAATGAT AAAAGATACTTACGATGCCCAGCAGCAATGACTGTGATGCACTTAAGAAAGTTTCTCAGA AGTAAAATGGACATACCTAATACTTTCCAGATTGATGTCATGTATGAGGAGGAACCTTTA AAGGATTATTATACACTAATGGATATTGCCTACATTTATACCTGGAGAAGGAATGGTCCA CTTCCATTGAAATACAGAGTTCGACCTACTTGTAAAAGAATGAAGATCAGTCACCAGAGA GATGGACTGACAAATGCTGGAGAACTGGAAAGTGACTCTGGGAGTGACAAGGCCAACAGC CCAGCAGGAGGTATTCCCTCCACCTCTTCTTGTTTGCCTAGCCCCAGTACTCCAGTGCAG TCTCCTCATCCACAGTTTCCTCACATTTCCAGTACTATGAATGGAACCAGCAACAGCCCC AGCGGTAACCACCAATCTTCTTTTGCCAATAGACCTCGAAAATCATCAGTAAATGGGTCA TCAGCAACTTCTTCTGGTTGA |
Restriction Sites | NotI-NotI |
ACCN | NM_005180 |
Insert Size | 2700 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_005180.5. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_005180.5, NP_005171.4 |
RefSeq Size | 3251 bp |
RefSeq ORF | 981 bp |
Locus ID | 648 |
UniProt ID | P35226 |
Domains | RING |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors |
Gene Summary | This gene encodes a ring finger protein that is major component of the polycomb group complex 1 (PRC1). This complex functions through chromatin remodeling as an essential epigenetic repressor of multiple regulatory genes involved in embryonic development and self-renewal in somatic stem cells. This protein also plays a central role in DNA damage repair. This gene is an oncogene and aberrant expression is associated with numerous cancers and is associated with resistance to certain chemotherapies. A pseudogene of this gene is found on chromosome X. Read-through transcription also exists between this gene and the upstream COMM domain containing 3 (COMMD3) gene. [provided by RefSeq, Sep 2015] |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
Bmi1 essentially mediates podocalyxin-enhanced Cisplatin chemoresistance in oral tongue squamous cell carcinoma
,Zhou, Y;Zhang, L;Pan, H;Wang, B;Yan, F;Fang, X;Munnee, K;Tang, Z;,
PLoS ONE
,PubMed ID 25915207
[BMI1]
|
Polycomb Group Proteins as Epigenetic Mediators of Neuroprotection in Ischemic Tolerance
,Martha Stapels, Chelsea Piper, Tao Yang, Minghua Li, Cheri Stowell, Zhi-gang Xiong, Julie Saugstad, Roger P. Simon, Scott Geromanos, James Langridge, Jing-quan Lan, and An Zhou,
Sci. Signal., Mar 2010; 3: ra15
[BMI1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202871 | BMI1 (Myc-DDK-tagged)-Human BMI1 polycomb ring finger oncogene (BMI1) |
CNY 3600.00 |
|
RC202871L1 | Lenti ORF clone of Human BMI1 polycomb ring finger oncogene (BMI1), Myc-DDK-tagged |
CNY 6000.00 |
|
RC202871L2 | Lenti ORF clone of Human BMI1 polycomb ring finger oncogene (BMI1), mGFP tagged |
CNY 5890.00 |
|
RC202871L3 | Lenti ORF clone of Human BMI1 polycomb ring finger oncogene (BMI1), Myc-DDK-tagged |
CNY 6000.00 |
|
RC202871L4 | Lenti ORF clone of Human BMI1 polycomb ring finger oncogene (BMI1), mGFP tagged |
CNY 6000.00 |
|
RG202871 | BMI1 (tGFP-tagged) - Human BMI1 polycomb ring finger oncogene (BMI1) |
CNY 5200.00 |