IDH3A (NM_005530) Human Untagged Clone

CAT#: SC116711

IDH3A (untagged)-Human isocitrate dehydrogenase 3 (NAD+) alpha (IDH3A), nuclear gene encoding mitochondrial protein



  "NM_005530" in other vectors (7)

CNY 3656.00

CNY 7220.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-IDH3A mouse monoclonal antibody, clone OTI2F11 (formerly 2F11)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RP90
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC116711 sequence for NM_005530 edited (data generated by NextGen Sequencing)
ATGGCTGGGCCCGCGTGGATCTCCAAGGTCTCTCGGCTGCTGGGGGCATTCCACAACCCA
AAACAGGTGACCAGAGGTTTTACTGGTGGTGTTCAGACAGTAACTTTAATTCCAGGAGAT
GGTATTGGCCCAGAAATTTCAGCTGCAGTTATGAAGATTTTTGATGCTGCCAAAGCACCT
ATTCAGTGGGAGGAGCGGAACGTCACTGCCATTCAAGGACCTGGAGGAAAGTGGATGATC
CCTTCAGAGGCTAAAGAGTCCATGGATAAGAACAAGATGGGCTTGAAAGGCCCTTTGAAG
ACCCCAATAGCAGCCGGTCACCCATCTATGAATTTACTGCTGCGCAAAACATTTGACCTT
TACGCGAATGTCCGACCATGTGTCTCTATCGAAGGCTATAAAACCCCTTACACCGATGTA
AATATTGTGACCATTCGAGAGAACACAGAAGGAGAATACAGTGGAATTGAGCATGTGATT
GTTGATGGAGTCGTGCAGAGTATCAAGCTCATCACCGAGGGGGCGAGCAAGCGCATTGCT
GAGTTTGCCTTTGAGTATGCCCGGAACAACCACCGGAGCAACGTCACGGCGGTGCACAAA
GCCAACATCATGCGGATGTCAGATGGGCTTTTTCTACAAAAATGCAGGGAAGTTGCAGAA
AGCTGTAAAGATATTAAATTTAATGAGATGTACCTTGATACAGTATGTTTGAATATGGTA
CAAGATCCTTCCCAATTTGATGTTCTTGTTATGCCAAATTTGTATGGAGACATCCTTAGT
GACTTGTGTGCAGGATTGATCGGAGGTCTCGGTGTGACACCAAGTGGCAACATTGGAGCC
AATGGGGTTGCAATTTTTGAGTCGGTTCATGGGACGGCTCCAGACATTGCAGGCAAGGAC
ATGGCGAATCCCACAGCCCTCCTGCTCAGTGCCGTGATGATGCTGCGCCACATGGGACTT
TTTGACCATGCTGCAAGAATTGAGGCTGCGTGTTTTGCTACAATTAAGGACGGAAAGAGC
TTGACAAAAGATTTGGGAGGCAATGCAAAATGCTCAGACTTCACAGAGGAAATCTGTCGC
CGAGTAAAAGATTTAGATTAA

Clone variation with respect to NM_005530.2
24 t=>c
Restriction Sites NotI-NotI     
ACCN NM_005530
Insert Size 2600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation A True Clone.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_005530.2, NP_005521.1
RefSeq Size 2701 bp
RefSeq ORF 1101 bp
Locus ID 3419
UniProt ID P50213
Domains isodh
Protein Pathways Citrate cycle (TCA cycle), Metabolic pathways
Gene Summary Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the alpha subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...