MAB21L1 (NM_005584) Human Untagged Clone
CAT#: SC116669
MAB21L1 (untagged)-Human mab-21-like 1 (C. elegans) (MAB21L1)
CNY 3656.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CAGR1; COFG; Nbla00126 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_005584, the custom clone sequence may differ by one or more nucleotides
ATGATTGCGGCCCAGGCCAAGCTGGTCTACCATCTGAATAAATACTACAACGAAAAATGCCAAGCCAGGA AAGCTGCCATTGCCAAAACTATCCGGGAAGTCTGCAAAGTAGTTTCCGACGTACTGAAGGAAGTGGAAGT GCAGGAGCCGCGGTTCATCAGCTCTCTCAACGAGATGGACAATCGCTACGAGGGCCTCGAGGTCATCTCC CCCACCGAATTTGAAGTGGTGCTTTATCTCAACCAAATGGGGGTGTTCAACTTCGTGGACGATGGCTCAC TGCCCGGCTGCGCGGTGCTGAAGTTGAGCGACGGGCGCAAGAGGAGCATGTCCCTCTGGGTGGAATTCAT TACCGCCTCCGGCTACCTCTCGGCGCGCAAAATCCGGTCCAGGTTTCAGACGCTGGTGGCTCAAGCGGTA GACAAATGTAGCTACCGGGATGTGGTAAAGATGGTGGCAGACACCAGCGAAGTGAAACTGAGAATCCGAG ATAGGTACGTGGTGCAGATCACGCCGGCCTTTAAATGCACCGGGATCTGGCCGAGGAGTGCTGCCCACTG GCCACTTCCCCACATCCCCTGGCCGGGACCCAACCGGGTGGCGGAGGTCAAGGCGGAAGGTTTCAATCTC TTGTCCAAGGAGTGCCACTCCTTGGCCGGCAAGCAGAGCTCGGCGGAGAGCGACGCCTGGGTGCTGCAGT TCGCGGAGGCAGAGAACAGACTGCAGATGGGGGGCTGCAGAAAGAAGTGCCTCTCCATCCTCAAAACCTT AAGGGATCGTCACCTTGAACTGCCGGGCCAGCCCTTGAACAATTACCATATGAAGACTCTGGTTTCCTAC GAGTGTGAAAAGCATCCCCGAGAGTCGGACTGGGACGAGTCTTGCCTGGGTGATCGGCTGAACGGGATTT TGCTGCAACTTATCTCCTGCCTGCAGTGCCGGCGGTGTCCCCACTACTTTCTACCGAACTTAGATCTGTT TCAAGGCAAACCTCACTCAGCTCTGGAAAACGCTGCCAAACAAACGTGGCGACTGGCAAGAGAGATCCTG ACCAACCCGAAAAGTTTGGAAAAACTTTAG |
| Restriction Sites | NotI-NotI |
| ACCN | NM_005584 |
| Insert Size | 2940 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_005584.2, NP_005575.1 |
| RefSeq Size | 2465 bp |
| RefSeq ORF | 1080 bp |
| Locus ID | 4081 |
| UniProt ID | Q13394 |
| Domains | Mab-21 |
| Gene Summary | This gene is similar to the MAB-21 cell fate-determining gene found in C. elegans. It may be involved in eye and cerebellum development, and it has been proposed that expansion of a trinucleotide repeat region in the 5' UTR may play a role in a variety of psychiatric disorders. [provided by RefSeq, Oct 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC207010 | MAB21L1 (Myc-DDK-tagged)-Human mab-21-like 1 (C. elegans) (MAB21L1) |
CNY 3656.00 |
|
| RC207010L1 | Lenti ORF clone of Human mab-21-like 1 (C. elegans) (MAB21L1), Myc-DDK-tagged |
CNY 6056.00 |
|
| RC207010L2 | Lenti ORF clone of Human mab-21-like 1 (C. elegans) (MAB21L1), mGFP tagged |
CNY 5890.00 |
|
| RC207010L3 | Lenti ORF clone of Human mab-21-like 1 (C. elegans) (MAB21L1), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC207010L4 | Lenti ORF clone of Human mab-21-like 1 (C. elegans) (MAB21L1), mGFP tagged |
CNY 5890.00 |
|
| RG207010 | MAB21L1 (tGFP-tagged) - Human mab-21-like 1 (C. elegans) (MAB21L1) |
CNY 5256.00 |
其它MAB21L1产品
