TIMM17B (NM_005834) Human Untagged Clone

CAT#: SC116485

TIMM17B (untagged)-Human translocase of inner mitochondrial membrane 17 homolog B (yeast) (TIMM17B), nuclear gene encoding mitochondrial protein, transcript variant 2



  "NM_005834" in other vectors (5)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TIMM17B Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DXS9822; JM3; TIM17B
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_005834.1 GCCATGGAGGAGTACGCTCGGGAGCCCTGCCCATGGCGAATTGTGGATGATTGCGGTGGA
GCCTTCACTATGGGTGTCATCGGTGGCGGAGTCTTCCAGGCCATCAAGGGTTTCCGCAAT
GCCCCTGTTGGAATTCGGCACCGGTTGAGAGGTAGTGCCAATGCTGTGAGGATCCGAGCC
CCCCAGATTGGAGGTAGCTTCGCAGTGTGGGGGGGCCTGTTCTCCACCATTGACTGTGGC
CTGGTGCGGCTTCGGGGCAAGGAGGATCCCTGGAACTCTATCACCAGTGGAGCATTGACC
GGGGCTGTGCTGGCTGCCCGCAGTGGCCCACTGGCCATGGTGGGCTCAGCAATGATGGGG
GGCATCCTGTTGGCCCTCATTGAGGGCGTTGGCATCCTCCTCACTCGCTACACAGCCCAG
CAGTTCCGAAATGCGCCCCCATTCCTGGAGGACCCCAGCCAGCTGCCCCCTAAGGATGGC
ACCCCGGCCCCAGGCTACCCCAGCTATCAGCAGTACCACTGAGGAAGCCACTGCCACCAT
GGGAGCTACTTCTCGGTTCCCTCCCCGATGGTCTACCTCGAAGGGAGGGCTGGCTCCCAG
TTAGCCCTGGGACCCTCCAGAGAGGGTTTCTACTCTGCTCCCTAGTCCCAGGGTGGGGGT
GGGGCACCCCAGCTGCCCTGACAGATGGGTCCCCTTTTTCTCTCTCAGGGCACCCCAGCC
CCACACTCACATGTACGAAGTTCTCACCCCAGCTCCTTTGTGTGGCACCCTGATGAGTAT
TTAAAGCCCGTTTTGAAATGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites NotI-NotI     
ACCN NM_005834
Insert Size 950 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_005834.1, NP_005825.1
RefSeq Size 960 bp
RefSeq ORF 519 bp
Locus ID 10245
UniProt ID O60830
Domains Tim17
Protein Families Transmembrane
Gene Summary This gene encodes a multipass transmembrane protein that forms an integral component of the mitochondrial translocase TIM23 complex. This complex facilitates the transport of mitochondrial proteins from the cytosol across the mitochondrial inner membrane and into the mitochondrion. There is a pseudogene for this gene on chromosome 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2, also known as hTim17b) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...