MRPS33 (NM_016071) Human Untagged Clone

CAT#: SC114481

MRPS33 (untagged)-Human mitochondrial ribosomal protein S33 (MRPS33), nuclear gene encoding mitochondrial protein, transcript variant 1



  "NM_016071" in other vectors (4)

CNY 1200.00

CNY 2950.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal anti-MRPS33 antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGI-139; MRP-S33; PTD003; S33mt
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC114481 sequence for NM_016071 edited (data generated by NextGen Sequencing)
ATGTCCTCCCTTTCAGAATATGCCTTCCGCATGTCTCGTCTCAGTGCCCGGCTATTTGGT
GAAGTCACCAGGCCTACTAATTCCAAGTCTATGAAAGTGGTGAAACTGTTTAGTGAACTG
CCCTTGGCCAAGAAGAAGGAGACTTATGATTGGTATCCAAATCACCACACTTACGCTGAA
CTCATGCAGACGCTCCGATTTCTTGGACTCTACAGAGATGAGCATCAGGATTTTATGGAT
GAGCAAAAACGACTAAAGAAGCTTCGTGGAAAGGAGAAACCAAAGAAAGGAGAAGGGAAA
AGAGCAGCAAAAAGGAAATAG

Clone variation with respect to NM_016071.3
>OriGene 5' read for NM_016071 unedited
GGCTTCAGGATTTGTATACGACTCACTATAGGCGGCCGCGAATTCGCACGAGGGCACTGT
AGCTTTGGGTGGTGGGCTGCAGATTAATTTTGTAACCACCTTAAGAAAAATACGGAACTC
TAACTCCTTGCCACTCAAGAAATGTCCTCCCTTTCAGAATATGCCTTCCGCATGTCTCGT
CTCAGTGCCCGGCTATTTGGTGAAGTCACCAGGCCTACTAATTCCAAGTCTATGAAAGTG
GTGAAACTGTTTAGTGAACTGCCCTTGGCCAAGAAGAAGGAGACTTATGATTGGTATCCA
AATCACCACACTTACGCTGAACTCATGCAGACGCTCCGATTTCTTGGACTCTACAGAGAT
GAGCATCAGGATTTTATGGATGAGCAAAAACGACTAAAGAAGCTTCGTGGAAAGGAGAAA
CCAAAGAAAGGAGAAGGGAAAAGAGCAGCAAAAAGGAAATAGTGTTGGTCCCTCAAGAGG
GAGACTTTCTTCCTCAGTGGCGGAGAGAAGAAAGTGCATTTATTGTCTTTCCACATATTG
GAGGAATGTCATCTTCCTAAATGAAGTTTATTTGGAGGAACACAGTCATCTCCTTGGTGA
AATCTAATCCGGTTACATTGTGGCTGGTTTCTTGAACACATTCTAACTGTGCAAAATTAT
CTTGGCCTTGGCCGTGTAATGTGAGGTTTACCTGATTCTCTAATGAAATAAATACCTAAG
TTATTGTTTGATGATTTGTTTGGGGTGGGATGGGATGCTGGGGGAATGGAGGGGAAACCT
CATTAAGTGAGCATCCTATAGTGTCCTCATTTCTCCCTTCTTGCTTACTGACTCACCCAG
CCCTAAACTTCTTTCATCCTGGGCCTTTCAGCCACTGTCTCCACCACCAAGCTCACAAAC
TTTGNNGNNGTGTCTCACCTACTCCTTNGAGAATCTATAN
Restriction Sites NotI-NotI     
ACCN NM_016071
Insert Size 1610 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_016071.2, NP_057155.1
RefSeq Size 727 bp
RefSeq ORF 321 bp
Locus ID 51650
UniProt ID Q9Y291
Gene Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. The 28S subunit of the mammalian mitoribosome may play a crucial and characteristic role in translation initiation. This gene encodes a 28S subunit protein that is one of the more highly conserved mitochondrial ribosomal proteins among mammals, Drosophila and C. elegans. Splice variants that differ in the 5' UTR have been found for this gene; all variants encode the same protein. Pseudogenes corresponding to this gene are found on chromosomes 1q, 4p, 4q, and 20q [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...